Category Archives: Transhuman News

As the years went by and technology got better, investigators were able to use a small piece of bone to find answers.

HANCOCK COUNTY, Ind. A cold case spanning nearly three decades is finally solved, thanks to advancements in DNA testing.

The remains of "Jane Doe" were found under a Hancock County bridge 28 years ago this month. Neighbors have wondered about the identity of the woman whose remains were found in a wooded area in 1994.

"We didn't have a lot of stuff like that happening, so that's probably one of the reasons many people in the area didn't forget about it," Hancock County Sheriff's Det. Capt. Ted Munden said.

Investigators believe the remains were probably there for several months before they were discovered. That left very few clues about her identity.

"They did DNA testing back then, but the DNA technology wasn't as good as it is now," Munden said.

As the years went by and technology got better, they were able to use a small piece of bone to find the answers they were looking for.

"They were able to extract a partial DNA profile, and that profile was sent to a specialty lab where they could build it up even further and make it a comprehensive DNA profile that could be used to search through genealogy sites," Munden said.

Sites like Ancestry.com were used as tools. They were able to find a DNA match to distant family members of the woman now identified as 34-year-old Doreen M. Tiedman, from Cleveland, Ohio.

Family told Munden that Tiedman was a frequent hitchhiker, and the last time they spoke with her was January 1994.

"They never quit looking for her. As the years went on, I think they came to the realization she was probably deceased," Munden said. "It was nice to be able to let them know where she was at and get her remains back to have a proper burial."

The work is not over. Investigators want to know more about how Tiedman died and ended up underneath the bridge that day. They're asking anyone with information to contact the Hancock County Sheriffs Department at 317-477-1147.

What other people are reading:

More here:
Advancements in DNA testing help solve Hancock County cold case - WTHR

DNA profiling is frequently in the news. Public interest is sparked when DNA is used to identify a suspect or human remains, or resolves a cold case that seems all but forgotten.

Very occasionally, it is in the media when the process doesnt work as it should.

ADVERTISEMENT

CONTINUE READING BELOW

So what is DNA profiling and how does it work and why does it sometimes not work?

DNA profiling, as it has been known since 1994, has been used in the criminal justice system since the late 1980s, and was originally termed DNA fingerprinting.

The DNA in every human is very similar up to 99.9% identical, in fact. But strangely, about 98% of the DNA in our cells is not gene-related (i.e. has no known function).

This non-coding DNA is largely comprised of sequences of the four bases that make up the DNA in every cell.

But for reasons unknown, some sections of the sequence are repeated: an example is TCTATCTATCTATCTATCTA where the sequence TCTA is repeated five times. While the number of times this DNA sequence is repeated is constant within a person, it can vary between people. One person might have 5 repeats but another 6, or 7 or 8.

ADVERTISEMENT

CONTINUE READING BELOW

There are a large number of variants and all humans fall into one of them. The detection of these repeats is the bedrock of modern DNA profiling. A DNA profile is a list of numbers, based on the repeated sequences we all have.

The use of these short repeat sequences (the technical term is short tandem repeat or STR) started in 1994 when the UK Forensic Science Service identified four of these regions. The chance that two people taken at random in the population would share the same repeat numbers at these four regions was about 1 in 50,000.

Now, the number of known repeat sequences has expanded greatly, with the latest test looking at 24 STR regions. Using all of the known STR regions results in an infinitesimally small probability that any two random people have the same DNA profile. And herein lies the power of DNA profiling.

The repeat sequence will be the same in every cell within a person thus, the DNA profile from a blood sample will be the same as from a plucked hair, inside a tooth, saliva, or skin. It also means a DNA profile will not in itself indicate from what type of tissue it originated.

Consider a knife alleged to be integral to an investigation. A question might be who held the knife? A swab (cotton or nylon) will be moistened and rubbed over the handle to collect any cells present.

ADVERTISEMENT

CONTINUE READING BELOW

The swab will then be placed in a tube containing a cocktail of chemicals that purifies the DNA from the rest of the cellular material this is a highly automated process. The amount of DNA will then be quantified.

If there is sufficient DNA present, we can proceed to generate a DNA profile. The optimum amount of DNA needed to generate the profile is 500 picograms this is really tiny and represents only 80 cells!

DNA profiling is highly sensitive, given it can work from only 80 cells. This is microscopic: the tiniest pinprick of blood holds thousands of blood cells.

Consider said knife if it had been handled by two people, perhaps including a legitimate owner and a person of interest, yet only 80 cells are present, those 80 cells would not be from only one person but two. Hence there is now a less-than-optimal amount of DNA from either of the people, and the DNA profiling will be a mixture of the two.

Fortunately, there are several types of software to pull apart these mixed DNA profiles. However, the DNA profile might be incomplete (the term for this is partial); with less DNA data, there will be a reduced power to identify the person.

ADVERTISEMENT

CONTINUE READING BELOW

Worse still, there may be insufficient DNA to generate any meaningful DNA profile at all. If the sensitivity of the testing is pushed further, we might obtain a DNA profile from even a few cells. But this could implicate a person who may have held the knife innocently weeks prior to an alleged event; or be from someone who shook hands with another person who then held the knife.

This later event is called indirect transfer and is something to consider with such small amounts of DNA.

In forensics, using DNA means comparing a profile from a sample to a reference profile, such as taken from a witness, persons of interest, or criminal DNA databases.

By itself, a DNA profile is a set of numbers. The only thing we can figure out is whether the owner of the DNA has a Y-chromosome that is, their biological sex is male.

A standard STR DNA profile does not indicate anything about the persons appearance, predisposition to any diseases, and very little about their ancestry.

ADVERTISEMENT

CONTINUE READING BELOW

Other types of DNA testing, such as ones used in genealogy, can be used to associate the DNA at a crime scene to potential genetic relatives of the person but current standard STR DNA profiling will not link to anyone other that perhaps very close relatives parents, offspring, or siblings.

DNA profiling has been, and will continue to be, an incredibly powerful forensic test to answer whose biological material is this? This is its tremendous strength. As to how and when that material got there, thats for different methods to sort out.

Adrian Linacre, Professor of Forensic Genetics, Flinders University

This article is republished from The Conversation under a Creative Commons license. Read the original article.

Also Read | DART: NASAs crash was successful in shifting an asteroids orbit

ADVERTISEMENT

CONTINUE READING BELOW

Latest Stories

Read this article:
DNA is often used in solving crimes. But how does DNA profiling work? - EastMojo

CLARKSVILLE A man will spend 40 years behind bars after being linked to a 2019 Clarksville home invasion by DNA evidence.

Gareth Jones was sentenced Wednesday to four decades at the Indiana Department of Correction on a felony 1 burglary charge. He also received concurring sentences for related level two and level five felony charges.

Jones was convicted on the charges earlier this year.

The charges are from an incident that happened around Christmas in 2019, when an elderly Clarksville woman said Jones entered her home and viciously attacked her.

The woman was 85 years old and said she was pulled from her recliner and pushed face down onto a concrete floor on Dec. 27, 2019. Her face was repeatedly bashed into the floor and she sustained multiple injuries including a broken wrist, ribs and a fractured orbital socket.

Jones was charged with and convicted of stealing property from the woman as well.

Although the incident happened in 2019, it took time and DNA evidence to link Jones to the crimes. He was arrested on a domestic battery charge in Floyd County nearly a year later and evidence from that crime scene tipped investigators off about the case out of Clark County.

Clark County Deputy Prosecutor Tom Lowe said when Jones was arrested in Floyd County he was given a DNA swab.

Here is a case that by doing (the DNA swab at arrest) he was able to get into the system and we were able to match him (to this case,) he said.

The DNA from that swab matched a wallet that had been discarded in a dumpster near the victims home. It also matched clothing the victim was wearing at the time of the attack.

Clark County Prosecutor Jeremy Mull told the News and Tribune earlier that these types of home invasion cases are not common in Clark County.

I would say it is rare for a home invasion to happen where someone is attacked and injured by someone they dont know, Mull said.

Jones is still facing charges on the battery case in Floyd County. Court records indicate theres a hearing regarding a plea agreement in that case scheduled for Oct. 19.

Read the rest here:
40-year sentence after DNA links to violent Clarksville home invasion - Evening News and Tribune

Beijing [China], October 16 (ANI): The Chinese government has stooped to the lowest level possible when it comes to the repression of the Tibetan people but this forced DNA sample collection without consent to strengthen their own surveillance capabilities proves that they can go even lower if needed.

The Chinese authorities have apparently been collecting DNA samples of Tibetan people, children and adults across the region without taking their consent as per a new report published by Human Rights Watch.

Their report also contained evidence of the mass DNA database collection that took place under the guise of a crime detection drive in the area, reported The Geneva Daily.

China has always considered the complete sinicization of Tibet as its ultimate goal since its illegal occupation in the 1950s. They have oppressed the people of Tibet for more than six decades and continue to do so.

Tibetans in Tibet have no access to fundamental human rights, are always under the strict surveillance of the Communist party that is strengthened ever so often and are punished or imprisoned severely if they dont comply with the unfavourable Chinese policies and agendas, reported The Geneva Daily.

Human Genetics, a science journal took down a research paper that used DNA sample collections and it was fairly obvious how there was no consent taken from the victimized parties during the entire research process.

A UN Special Rapporteur commented on how the right to privacy notes that the DNA databases are subject to potential misuse for government surveillance, including identification of relatives and non-paternity, and the risk of miscarriages of justice.

The report by Human Rights Watch also had information about their findings in Nyemo county where the Chinese authorities collected DNA from children at three kindergartens, this became a controversial drive since there was no information on whether the parents were informed or if their consent was granted in such a delicate case, reported The Geneva Daily.

The report also suggests how it does not make sense at all to take DNA samples from kids under the claims of it is for the purpose to detect crime.

It further stated, DNA information is highly sensitive and can facilitate a wide array of abuses if collected or shared non-consensually.

Another report was published on September 13th, 2022 where Citizen Lab found out that Chinas police may have gathered between about 920,000 to 1.2 million DNA samples in the Tibet Autonomous Region over the past six years.

This figure sums up one-quarter to one-third of the total population of the Tibetan Autonomous Region. Human Rights Watch has also stated clearly in their reports how the Chinese authorities are leading a systematic collection of the DNA of the residents of the Tibetan Autonomous Region by taking blood from children as young as 5 without any say or consent from their parents, reported The Geneva Daily.

The International Campaign for Tibet stated that Chinas mass DNA collection of Tibetans is outrageous but it does not come as a surprise since China, since the illegal occupation has used Tibet as a laboratory for their coercive methods of social control, including the constant mass surveillance, the forced entry of the Chinese troops into Buddhist monasteries and religious institutions and the constant effort put into making Tibetans spy on their neighbours by using them as baits.

Moreover, China has not been open to any dialogue or negotiation with the Tibetan Government in Exile since 2010. The United States government has expressed their stand about how they think that the abuse will end if there is a peaceful negotiation between the two nations. The Promoting a Resolution to the Tibet-China Conflict Act by the US will supposedly pressure China to come to the negotiating table, reported The Geneva Daily.

Uzra Zeya, the US Special Coordinator for Tibetan Issues tweeted, Deeply disturbed by recent reports documenting involuntary, mass DNA collection throughout Tibet, including from children as young as 5 years old. We call on the PRC to stop these repressive policies and respect the fundamental freedoms of Tibetans. (ANI)

This report is auto-generated from ANI news service. ThePrint holds no responsibility for its content.

Read more:
Right groups disturbed over involuntary mass DNA collection throughout Tibet by China - ThePrint

Multiple scientists at Queensland's state-run forensics laboratory have detailed their alarm and confusion over a DNA testing procedure that was introduced after major concerns were raised about the previous testing procedure.

Scientist Ingrid Moeller told the commission of inquiry this week that the testing procedure was "disturbing" and "nonsensical".

The hearings heard evidence from scientists at Queensland Health Forensic and Scientific Services about a "toxic" work culture and issues with the testing of DNA samples related to major crimes like rapes and murders.

Counsel Assisting the Commissioner questioned several of them about the process introduced to replace a contentious testing threshold concerns over which initially sparked the royal commission-style inquiry.

From 2018, samples that fell below a certain threshold were classified "DIFP", or DNA Insufficient for Processing.

But additional testing has since successfully detected DNA in some samples, with reworks requested by the Queensland Police Service (the lab's major client) having a 66 per centsuccess rate for samples related to sex crimes.

When the Queensland government announced the public inquiry following a cabinet meeting in June six months after serious allegations about forensic testing were detailed in the Australian newspaper's podcast Shandee's Story the Health Minister Yvette D'Ath said the DIFP threshold would immediately be removed and every sample would be sent for DNA processing.

But instead of reverting to the process in place before 2018, a new process was instituted one that was baffling to several scientists at the lab, according to their evidence.

Independent forensics expert Kirsty Wright said the new protocol left out a critical step called micro-concentration a process resembling a reverse dilution, where the fluid is distilled so there's more DNA in the sample.

"If you didn't concentrate the sample, it means that you would have less DNA going on to be profiled, which means you have a much less chance of being able to obtain a DNA profile," Dr Wright explained.

The samples then go on to be amplified.

"Think of amplifying as photocopying," Dr Wright said.

"The amount of DNA we get at a crime scene it's not enough to be able to look at under the DNA instruments. We need to be able to photocopy the DNA, so we have billions and billions and billions of copies of the crime scene DNA, which is more than enough for us to be able to then look at that DNA, to be able to obtain a DNA profile and be able to read a DNA profile."

In a statement published by the commission, senior scientist Kylie Rika said she wasn't consulted about the change of process before it was announced.

"The process after 6 June, 2022 means that scientists were unable to process samples to the best of their judgement because the sample might require concentration prior to amplification."

Ms Rika said she raised her concerns at a management team meeting a few days later and was told by managing scientist Cathie Allen that a government minister chose the option at a meeting and the decision was therefore final.

"I have formed the impression that Cathie [Allen]and Justin [Howes]may want to avoid the use of the Microcon as it is costly in terms of labour/time due to it being a manual process as opposed to an automated process," Ms Rika's statement reads.

"I have wondered whether this decision has been made in an attempt to support the rationale behind the Options Paper that was presented to the QPS by Justin and Cathie in 2018."

That options paper resulted in the change to the DIFP threshold, and it came under criticism from internationally-renowned forensics expert Bruce Budowle in his evidence to the Commission last month.

Giving evidence last Monday, reporting scientist Alicia Quartermain said she questioned the new procedure when it was announced in June, saying she thought it wasn't the best way to process samples and asking MsAllen why the decision had been made.

"I remember her saying that they provided all the options to Premier and Cabinet and that was the option they went with, and that was why I questioned that, because that didn't make any scientific sense to me.

"In my opinion, it could be the difference between obtaining a usable, interpretable DNA profile and obtaining a DNA profile that can't be used."

Another reporting scientist, Ingrid Moeller, gave evidence that she didn't understand the June change.

"I was quite confused by this," she said.

"It's not something I would have done with these samples. It didn't make sense to me scientifically, and so I discussed it with other colleagues and similarly they were quite confused by it."

"It was quite disturbing actually. It was nonsensical, in my mind."

The commissioner heard Dr Moeller had raised concerns with a higher manager whether, if this was a ministerial decision, if the minister had been properly briefed.

Reporting scientist Rhys Parry said he believed this process to be problematic, and significantly lowered the chances of obtaining an "optimal" DNA profile.

Emma-Jayne Caunt, another reporting scientist, told the commission she also sent an email questioning the new process, believing the pre-2018 process was better.

On August 19 this year, the process was changed again.

The concentration process for samples was now that they'd be concentrated down to a certain volume not a full concentration and may undergo only one amplification process, so that some of the sample could be preserved.

In her statement, Ms Rika said she wasn't consulted on this change either, and she and Ms Caunt made a list of potential issues writing that a blanket approach was not appropriate, and compromises quality to obtain shorter turnaround times.

"The process places undue restrictions on the scientist to get the best result as permission is required from the QPS to perform a second amp. The QPS may not necessarily be in the position to determine whether a second amp might make a profile interpretable."

In his evidence, Rhys Parry speculated the August change was potentially because the QPS had lost faith in the laboratory.

"I kind of understood at the time that QPS might have been losing confidence in our ability to obtain DNA at low levels because of everything that had gone on, and maybe they were hedging their bets so that they could get it analysed elsewhere if they wanted to," he said.

"But from a scientific perspective, it wasn't the optimal decision because microconning that extra little bit doubles the DNA which is more likely to give you a good profile."

It was revealed in a September hearing of the commission that Queensland Police haverequested a pause on testing the samples, over concerns the new approach could exhaust the DNA.

Forensic scientist Kirsty Wright, who is following the inquiry very closely, said the commission was returning to the issue again and again.

"Both of those processes would have meant it was a lot less likely to be able to obtain a DNA profile.

"It really is an interesting question to ask. Why?"

The inquiry will hold public hearings for several more weeks, and MsAllen and MrHowes have not appeared before the commission to give evidence.

Commissioner Walter Sofronoff KC has already delivered an explosive interim report, finding that Queensland Health Forensic and Scientific Services had issued "untrue" or "misleading" statements regarding DIFP samples.

He called this a "profound issue" for the administration of criminal justice, the integrity of police investigations and decisions made by victims of crime.

Read more:
Inquiry reveals alarm and confusion among scientists over processes used at Queensland forensics lab for DNA testing - ABC News

Source: T. Schneider / Shutterstock.com

Its an unforgettable day for Ginkgo Bioworks (NYSE:DNA) as the company just disclosed a deal with pharmaceutical giant Merck (NYSE:MRK). Together, the two companies hope to innovate pharmaceutical manufacturing processes through the use of enzyme technology. There are financial implications here, as well. Ginkgo will receive a research and development fee up-front and can earn multiple milestone payments. Even with this major development, however, DNA stock struggled to move into the green this morning.

So, heres a small dose of science for you. Merck and Ginkgo Bioworks plan to engineer up to four enzymes for use as biocatalysts in Mercks active pharmaceutical ingredient (API) manufacturing efforts. In other words, Merck is tapping Ginkgo to provide its cell engineering and enzyme design capabilities to potentially improve the way modern medicines are manufactured.

What does each company bring to the table? To oversimplify it a bit, Mercks bringing the capital and the laboratories, while Ginkgos bringing the fungal strains. This could certainly be a medical-market game-changer, but what has been Wall Streets initial response?

By 11:00 a.m. Eastern, DNA stock fell into the red but then moved higher. To a certain extent, it followed the ups and downs of the major stock market indices this morning.

Perhaps it will take some time for investors to absorb all of the scientific terminologies in the press release. Or maybe, theyre still mulling over the fiscal implications of the Merck-Ginkgo deal.

Those implications are certainly worth noting, especially if youre holding DNA stock. The arrangement specifies that Ginkgo Bioworks will, at the very least, receive an up-front research and development fee. However, Ginkgo will also be eligible to earn success-based research and development milestone payments.

On top of all that, Ginkgo Bioworks can also earn commercial milestone payments for achieving a number of biocatalysis targets. All told, these milestones could add up to $144 million for Gingko.

Thus, this is potentially good news for the pharmaceutical market and terrific news for Ginkgo Bioworks. In time, all of this could have a profoundly positive impact on DNA stock.

On Penny Stocks and Low-Volume Stocks:With only the rarest exceptions,InvestorPlacedoes not publish commentary about companies that have a market cap of less than $100 million or trade less than 100,000 shares each day. Thats because these penny stocks are frequently the playground for scam artists and market manipulators. If we ever do publish commentary on a low-volume stock that may be affected by our commentary, we demand thatInvestorPlace.comswriters disclose this fact and warn readers of the risks.

Read More:Penny Stocks How to Profit Without Getting Scammed

On the date of publication, David Moadeldid not have (either directly or indirectly) any positions in the securities mentioned in this article.The opinions expressed in this article are those of the writer, subject to the InvestorPlace.comPublishing Guidelines.

David Moadel has provided compelling content and crossed the occasional line on behalf of Motley Fool, Crush the Street, Market Realist, TalkMarkets, TipRanks, Benzinga, and (of course) InvestorPlace.com. He also serves as the chief analyst and market researcher for Portfolio Wealth Global and hosts the popular financial YouTube channel Looking at the Markets.

Read more from the original source:
What Is Going on With Ginkgo Bioworks (DNA) Stock Today? - InvestorPlace

GRAND COULEE - A man who burglarized a residence in Grand Coulee in November 2021 has been convicted of 17 counts of crime after DNA evidence linked him to the offenses.

According to a Lincoln County Sheriffs Office press release on Thursday, Erik Skau was found guilty of various crimes ranging from malicious mischief to first-degree burglary with a deadly weapon.

Authorities refer to Skaus crime as a large residential burglary that involved the theft of firearms, vehicles and other items.

Lincoln County deputies seized evidence left at the scene which was processed by the WSP crime lab for DNA. A match for DNA was found in June 2022 and the suspect was named. Investigators went to Thurston County and served search warrants on a home where stolen property was recovered and Skau was arrested.

The Lincoln County Sheriffs Office worked with the Thurston County Sheriffs Office and Yelm Police to bring Skau to justice.

Continue reading here:
DNA match leads to conviction of man who committed armed burglary near Grand Coulee nearly one year ago - iFIBER One News

King Charles III is reportedly planning to launch a DNA investigation related to the 539-year-old Princes in the Tower murder mystery.

According to The Mirror, the new monarch is said to be interested in plans to test bones believed to be of Prince Edward and Prince Richard.

The two boys were imprisoned in the Tower of London in 1483 by their scheming uncle.

Speaking at Sandon Literature Festival in Staffordshire, Tracy Borman, joint curator of Historic Royal Palaces, said: He has said he would like an investigation to go ahead, so that we can determine, once and for all, how the young royals died.

The mystery which left historians baffled for decades was also explored largely by William Shakespeares play Richard III however Queen Elizabeth II never permitted testing of the remains.

Read more from the original source:
King Charles backs DNA test for Princes in the Tower murder mystery - The News International

Dear Amy: I have been dear friends with Constance for decades.

We live in different states and see each other periodically we are like sisters.

Constance has responsibility only for herself. I have a family, so therefore she has more disposable income than I do.

Constance prides herself on a frugal, cash-only lifestyle, and yet she dovetails off our streaming and shopping services.

I didnt think I minded, but I sort of do. I think she should offer to pay half of the cost. (Note that she has many redeeming qualities, and this is not a deal-breaker.)

We made a lighthearted comment about how the prices for these services are increasing and how they now show ads because so many people are mooching off the accounts of others.

When she inquired about a streaming service we did not have, she let us know giddily that she found access via another friend.

Ive wondered about others in this predicament (and I know there are others). Id appreciate your take on this.

Leechs BFF

Dear BFF: Some time back, a person I know let a friend have access to one of her streaming accounts. Then that same friend applied the same password to gain access to another streaming account without asking permission. (The person allowing access had foolishly reused her password for other accounts.)

OK Im the fool. All of that happened to me.

In response, I changed ALL of my passwords and the matter died right there. (The friendship died a few months later.)

Anyone you share access with could have access to your other data. It is a definite risk.

If you are willing to continue to do this, ask your friend to pay for half the cost its still a bargain for her and her subsidy could be very helpful in your household.

If she is truly like a sister to you well, this is how sisters should (but dont always) work things out: Honestly, fairly, and without hard feelings.

If your pal doesnt use any online or check payment options, she could pay you half of a full-years subscription cost by giving you cash.

Alternatively, you could continue to share your account with her, but reframe the way you cast her: Not as a mooch or a leech, but as someone happy to accept your generosity, which you are happy to bestow.

Dear Amy: Through a DNA search, I discovered a relative who has a much closer match with my first cousin than with me.

After corresponding with my DNA match and both of us giving it considerable thought, we have concluded that she was probably fathered by my uncle the father of my first cousins making her their half-sister.

My uncle died long ago. The new cousin would like to contact her half-siblings. I also believe that they have a right to know about her.

I wouldnt want to just drop the issue on them.

I am not close to these cousins. I live in a totally different part of the country, but I do keep loosely in touch about once a year.

I need guidance in how to handle this situation. My husband says to leave it alone.

Do you have ideas?

-- DNA Matched

Dear Matched: If you know through the DNA testing site that this person is a closer DNA match with your cousin than with you, then might your cousin also be registered on the site? If so, then the site might have already matched them together.

Regardless, this does not seem overly complicated to me. You could contact one of these cousins to say, I have located a DNA relative through a testing site. This person would also like to contact your branch of the family. Is it OK if I share your email address with her?

Once you connect these two branches, you can hope that the graft will mend and your family tree will successfully expand. It is not in your control.

Dear Readers: Have you ever had your question published in the Ask Amy column? If so, Id love to hear from you. Did you accept or reject my advice? Was the issue you wrote about ever resolved?

As part of our ongoing conversation about human behavior and its consequences, Id love to learn how things turned out for you.

Please, get in touch! Write to me at askamy@amydickinson.com. Write UPDATE in the subject line, and tell me your story.

I welcome the opportunity to be back in touch.

(You can email Amy Dickinson at askamy@amydickinson.com or send a letter to Ask Amy, P.O. Box 194, Freeville, NY 13068. You can also follow her on Twitter @askingamy or Facebook.)

2022 Amy Dickinson. Distributed by Tribune Content Agency, LLC.

Original post:
Ask Amy: DNA match leads to likely father who has died, but should half-siblings be told? - MassLive.com

Gardai used DNA to identify a man from Laois who had stolen hundreds of euros worth of fuel from a tractor in Offaly.

William McInerney, 33, of 13 Bruach na hAbhainn, Portlaoise admitted stealing the diesel worth 400 and tools worth 100 from the tractor at Ballycollin, Geashill, Offaly between September 15 and 16, 2020.

Sgt JJ Kirby said Gardai investigating the theft of 400 from a tractor in Offaly found a syphon at the scene. DNA was taken from the syphon hose, he explained. The was sent to the Garda forensic laboratory and the DNA matched the accused. Sgt Kirby said the man has 20 previous convictions.

When Judge Andrew Cody asked about the mans convictions, Sgt Kirby described him as someone who would have a history. He is always on the garda radar, he added.

Solicitor Philip Meagher said his client had separated briefly from his wife at the time of the offence. He fell into old company and he got involved in this particular enterprise, he said.

He said the defendant had brought full compensation, a letter of apology and was now working with a Laois Traveller group and the Mens Shed. This particular event was an aberration in what was otherwise a better path than he had been following, Mr Meagher told the sitting of Portlaoise District Court. It certainly wasnt a campaign of activity, he added.

Judge Andrew Cody warned the defendant to be very careful for the next two years as he handed him a three month sentence suspended for 24 months.

ADVERTISEMENT - CONTINUE READING BELOW

Read more:
DNA on syphon led to fuel theft arrest of man in Laois - Laois Live