Category Archives: Evolution

As those of you who read my column know, I like to share the interesting history of food. Food is a blessing many of us never think about. It is available to us anytime, hungry or not. Unfortunately this is still not so among many people in various countries even today.

I recently read a book about the history of how we cook and eat. The title is Consider the Fork, by Bee Wilson. You might enjoy reading it. Here are a few interesting tidbits from the book. There is much information behind each discovery.

The history of food begins with fire. We do not know how the first fire was made, how people became interested in it, nor how much fuel could be found to keep it fed. How did they restart it again if it ever went out? Before fire was used with food, people ate whatever they found. It may have been raw edible nuts, meat, insects, plants, berries, fish or sea food, if that was available. Fire revolutionized their diets.

In the beginning people had to learn how to cook using fire. Other than a spit construction, hot rocks or shells, there was nothing to use in, on, or above the fire to hold water or contents. There were no pots or containers. But people are very creative and figured out how to make containers out of various materials that would survive in or near the hot fire. Hot rocks were added inside the container to cook the food. A stick could be used to stir the contents.

Primitive ovens were eventually built. Later on as ovens were being refined, a piece of paper could be put in the oven to check for the temperature. The heat changed the color of the paper.

Having an oven to bake in brought many changes with food. Centuries ago it was found that adding an egg to batter created a lighter product that rose in height and was more tender. Cakes became popular! The sugar, if one had some, came in a 5 to 50 pound block and was chipped off when needed. As clocks were not available some foods were cooked according to the time one said a prayer. The cook knew how long it would take to say a Pater Noster (Our Father) or other prayers they knew by heart.

When cookbooks were being written there were no standardized measuring items. The ingredients were referred to by the size or shape of a familiar object such as a cup, an egg, a walnut, a handful or pinch. The recipes turned out pretty much okay as the cook used the same object when they cooked. Compare that now with standardized measuring devices, the cup, quart, etc., which American Fannie Merritt Farmer devised and promoted. However, other countries use the metric system and a scale is often used to more accurately weigh ingredients.

When ice became an industrial commodity, the railroad changed the diets of people as food could be kept cold while being transported. Another commodity we may use at times we cook may be opening a metal can. The canning procedure was invented by Nicolas Appert during Napoleons war with Britain in 1795. However, there was no can opener until 50 year later! One had to be inventive to open the can.

Do you use an ice cream maker? One of the first ice cream makers was invented by Nancy Johnson and took 3 minutes to make. However, unknown to her, the cheap zinc used was a poisonous metal. Tupperware was sold to help keep food fresh in your new-type refrigerator.

For an experiment, take your wooden spoon and look at it. A very simple plain tool many cooks use. What interesting history could be associated with it? The first paragraph of the introduction to the above mentioned book is about the wooden spoon. Knife, fork and spoon inventions are also very interesting.

The next time you place a pan containing water and a food ingredient on your hot stove burner, think about the miracle of things we take for granted.

Experiments, mistakes and technologies, past and present, and also new ideas, now play a large part in our foods and appliances we use.

Something to Think About: Fire, probably the greatest (discovery) excepting language, ever made by man. Charles Darwin, on cooking.

(Place on a hot rock to cook. Or use the BBQ.)

1 Tablespoon milk or cream

1 teaspoon dried parsley flakes

People are also reading

8 to 16 strips broiled bacon

Beat the eggs, cream, parsley, garlic and allspice. Coat the cleaned trout inside and out with the mixture. Put 1 to 2 strips bacon in each trout and place in an oiled wire broiler basket or on a greased hot grill. Broil fish over hot coals for 20 minutes or till fish flakes with a fork. Turn once. Serve with lemon wedges.

(To whip fluffy egg whites, use your bundle of tied reeds and hand whip 1/2 to 3 hours. Or use your electric mixer.)

1/4 teaspoon cream of tartar

For 9 pie, separate eggs. Whites will whip fluffier if at room temperature. Beat egg whites with vanilla and cream of tartar till soft peaks form. Gradually add sugar, beating till stiff and glossy and all sugar is dissolved. Spread meringue over filling sealing meringue to edges of pastry to prevent shrinking. Bake in a moderate oven (350 F.) 12 to 15 minutes or till peaks of meringue are golden brown.

(Place in your ice box to set. Or use your refrigerator.)

18 graham crackers, crumbled

2 heaping Tablespoons powdered sugar

1 (10-1/2 ounce) pkg. small marshmallows

1 can prepared cherry pie filling

Mix the graham cracker crumbs, butter and sugar. Put half of this crumb mixture in the bottom of a 7x11 pan. Mix the whipped cream, powdered sugar and marshmallows and place half of this mixture over the crumbs in the pan. Next spread on the pie filling, then the rest of the cream mixture. Top with remaining cracker crumbs. Refrigerate overnight.

Get local news delivered to your inbox!

View original post here:

The evolution of cooking and subsequent inventions - AgUpdate

WATCH TIME: 3 minutes

"I think whats missed over time is the burden of the treatments we use. What are the side effects to the treatments for myasthenia gravis? You had these situations where patients are doing better from a Myasthenia standpoint but having other symptoms that arent acceptable to them."

Over the past century, the prevalence of myasthenia gravis (MG) has increased; however, mortality has declined because of the development of effective treatments. Some of the first treatments for the disease began in the 1930s, followed by more common use of corticosteroids and plasma exchange in the 1960s. Over the past 2 decades, there have been more notable approvals, such as mycophenolate mofetil in 2008, rituximab (Rituxan; Genentech) in 2012, eculizumab (Soliris; Alexion) in 2017, and most recently, ravulizumab (Ultomiris; AstraZeneca) in 2022.

Ravulizumab, FDA-approved in April, became the first long-acting C5 compliment inhibitor for patients with MG, representing another feat for the community. At the 2022 American Association of Neuromuscular and Electrodiagnostic Medicine (AANEM) annual meeting, September 21-24, in Nashville, Tennessee, Nicholas Silvestri, MD, presented a talk on the evolution of treatment options for MG, including the common immunosuppressives used. Additionally, he detailed the efficacy and safety profiles of these therapeutics and highlighted how each are used when inadequate responses are found.

Silvestri, a clinical professor of neurology at the University at Buffalo, sat down with NeurologyLive at AANEM 2022 to discuss his presentation, along with the significant changes in the treatment paradigm, improvements in overall efficacy to these agents, and the need for increased awareness of the negative side effects.

Click here for more coverage of AANEM 2022.

Read the original post:

Evaluating the Treatment Evolution of Myasthenia Gravis and Use of Immunosuppressants: Nicholas Silvestri, MD, FAAN - Neurology Live

In the late 90s, Mitsubishi wanted to take its Dakar program to a production-based class. The company's Pajero Evolution racer, however, was a far cry from the road car that gave it a name. The solution was a homologation special, a three-year run of road-going Pajero Evolutions. Just a few thousand of these unique super-SUVs were ever built, all sold in Japan. 25 years have passed, which means the earliest Pajero Evolutions are finaly legal for import into the U.S. and the long-forbidden homologation special is now available to American buyers. That means the timing of this Pajero Evolution's sale could not be better.

The car, currently in Scotland, is about to be listed on Collecting Cars. While the car does not have a full listing yet and the auction has not actually begun, the published photos show a particularly well-kept white Pajero Evo. This particular car is an automatic, but the site also has a manual 1997 model coming up for sale soon in Australia if that's a dealbreaker for you. Previous Pajero Evos on the site have sold as high as $52,000 and as low as $16,000.

While it seems to be in pristine condition, this car has not lived in a garage waiting to be sold as a collector item elsewhere. A listed 180,000 kilometers translates to roughly 112,000 miles on the odometer, a well-used life of being driven for a car from 1997 even if that car weren't a Japan-only Dakar homologation special.

Excerpt from:

Buy This Glorious Pajero Evolution, Live Out JDM Off-Road Dreams - Road & Track

Ethical statement

This research project was ethically reviewed and approved by the Ethics Committee of the Instituto Gulbenkian de Cincia (license reference: A009.2018), and by the Portuguese National Entity that regulates the use of laboratory animals (DGAV - Direo Geral de Alimentao e Veterinria (license reference: 008958). All experiments conducted on animals followed the Portuguese (Decreto-Lei n 113/2013) and European (Directive 2010/63/EU) legislations, concerning housing, husbandry and animal welfare.

The ancestral invader E. coli strain expresses a Yellow Fluorescent Protein (YFP), and carries streptomycin and ampicillin resistance markers for easiness of isolation from the mouse feces [galK::amp (pZ12)::PLlacO1-YFP, strR (rpsl150), lacIZYA::scar]. An E. coli strain used for the in vivo competition experiments is isogenic to the ancestral invader but expresses a Cyan Fluorescent Protein (CFP) and carries streptomycin and chloramphenicol resistance markers [galK::chlor (pZ12)::PLlacO1-CFP, strR (rpsl150), lacIZYA::scar]. The resident E. coli lineage was isolated from the feces along time using McConkey + 0.4% lactose medium, as previously described9. All the resident clones sampled from each mouse belong to E.coli phylogenetic group B9.The invader E. coli strains (YFP and CFP) derive from the K-12 MG1655 strain (DM08) and exhibit a gat negative phenotype, gatZ::IS112. The resident E. coli clone used for the competition experiments in the mouse gut expresses a mCherry fluorescent protein and a chloramphenicol resistance marker, allowing to distinguish the invader and resident strains in the mice feces.

E. coli clones were grown at 37C under aeration in liquid media Luria broth (LB) from SIGMA or McConkey and LB agar plates. Media were supplemented with antibiotics streptomycin (100g/mL), ampicillin (100g/mL) or chloramphenicol (30g/mL) when specified.

Serial plating of 1X PBS dilutions of feces in LB agar plates supplemented with the appropriate antibiotics were incubated overnight and YFP, CFP or mCherry-labeled bacterial numbers were assessed by counting the fluorescent colonies using a fluorescent stereoscope (SteREO Lumar, Carl Zeiss). The detection limit for bacterial plating was ~300 CFU/g of feces9.

All mice (Mus musculus) used in this study were supplied by the Rodent Facility at Instituto Gulbenkian de Cincia (IGC) and were given ad libitum access to food (Rat and Mouse No.3 Breeding (Special Diets Services) and water. Mice were kept at 20-24C and 40-60% humidity with a 12-h light-dark cycle. For the in vivo evolution experiment we used the gut colonization model previously established9. Briefly, mice drank water with streptomycin (5g/L) only for 24h before a 4h starvation period of food and water. The animals were then inoculated by gavage with 100L of an E. coli bacterial suspension of ~108 colony-forming units (CFUs). Mice A2, B2, D2, E2, G2, H2 and I2 were successfully colonized with the invader E. coli, while mice C2 and F2 failed to be colonized. Six- to eight-week-old C57BL/6J non-littermate female mice were kept in individually ventilated cages under specified pathogen-free (SPF) barrier conditions at the IGC animal facility. Fecal pellets were collected during more than one year (>400 days) and stored in 15% glycerol at 80C for later analysis. In the competition experiments between the invader ancestral E. coli and evolved populations, we colonized the mice using a 1:1 ratio of each genotype, with bacterial loads being assessed and frozen on a daily basis after gavage.

In vivo competition experiments in which the two modes of selection (directional and diversifying) were acting for a longer time period were performed using evolved invader E. coli populations colonizing mice D2, B2 and A2, H2. Here we used both male (n=8) and female (n=8) C57BL/6J mice aged six- to eight-week-old treated with streptomycin during 3 days before gavage. E. coli populations evolving for short time periods do not allow for strong conclusions on which mode of selection is taking place. Evolved invader populations such as I2 or G2 were therefore not used for in vivo fitness assays. To assess the impact of the mouse resident E. coli in the competitive fitness of dgoR we performed one-to-one competitions between the invader ancestral and dgoR KO clones. We first homogenized the mice microbiotas by co-housing the animals during seven days. The animals (n=6, female C57BL/6J mice aged six- to eight-week-old) were then maintained under co-housing and given streptomycin-supplemented (5g/L) water during seven days to break colonization resistance and eradicate their resident E. coli. At this point, the co-housed mice were removed from the antibiotic-supplemented water for two days. The following day, one group of mice was gavaged with an mCherry-expressing resident E. coli (n=3 mice) while the other group (n=3) was not, with all animals being individually caged from this point on and receiving normal water without antibiotic. The day after gavage, all mice were colonized with a mix (1:1) of the invader ancestral and the dgoR KO clones, and the bacterial loads were assessed and frozen on a daily basis.

Fecal DNA was extracted with a QIAamp DNA Stool MiniKit (Qiagen), according to the manufacturers instructions and with an additional step of mechanical disruption32. 16S rRNA gene amplification and sequencing was carried out at the Gene Expression Unit from Instituto Gulbenkian de Cincia, following the service protocol. For each sample, the V4 region of the 16S rRNA gene was amplified in triplicate, using the primer pair F515/R806, under the following PCR cycling conditions: 94C for 3min, 35 cycles of 94C for 60s, 50C for 60s, and 72C for 105s, with an extension step of 72C for 10min. Samples were then pair-end sequenced on an Illumina MiSeq Benchtop Sequencer, following Illumina recommendations. Sampling for microbiota analysis was performed until the microbiota composition stabilized (~1 year after the antibiotic perturbation).

QIIME2 version 2017.1133 was used to analyze the 16S rRNA sequences by following the authors online tutorials (https://docs.qiime2.org/2017.11/tutorials/). Briefly, the demultiplexed sequences were filtered using the denoise-single command of DADA2 version 1.1434, and forward and reverse sequences were trimmed in the position in which the 25th percentiles quality score got below 20. Diversity analysis was performed following the QIIME2 tutorial35. Beta diversity distances were calculated through Unweighted Unifrac36. For taxonomic analysis, OTU were picked by assigning operational taxonomic units at 97% similarity against the Greengenes database version 13 (Greengenes 13_8 99% OTUs (250bp, V4 region 515F/806R))37.

DNA was extracted38 from E. coli populations (mixture of>1000 clones) or a single clone growing in LB plates supplemented with antibiotic to avoid contamination. DNA concentration and purity were quantified using Qubit and NanoDrop, respectively. The DNA library construction and sequencing were carried out by the IGC genomics facility using the Illumina Miseq platform. Processing of raw reads and variants analysis was based on the previous work39. Briefly, sequencing adapters were removed using fastp version 0.20.040 and raw reads were trimmed bidirectionally by 4bp window sizes across which an average base quality of 20 was required to be retained. Further retention of reads required a minimum length of 100bps per read containing at least 50% base pairs with phred scores at or above 20. BBsplit (part of BBMap version 38.9)41 was used to remove likely contaminating reads as explained previously39. Separate reference genomes were used for the alignment of invader (K-12 (substrain MG1655; Accession Number: NC_000913.2)) and resident (Accession Number: SAMN15163749) E. coli genomes. Alignments were performed via three alignment approaches: BWA-sampe version 0.7.1742, MOSAIK version 2.743, and Breseq version 0.35.144,45. Final average alignment depths for invader and resident populations across time points equalled 302 (median=236) and 253 (median=235), respectively. While Breseq provides variant analysis in addition to alignment, other variant calling approaches were used to identify putative variation in the sequenced genomes, and to verify data from Breseq. A nave pipeline39 using the mpileup utility within SAMtools version 1.946 and a custom script written in python was employed. Only reads with a minimum mapping quality of 20 were considered for analysis, and variant calling was limited to bases with call qualities of at least 30. At these positions, a minimum of 5 quality reads had to support a putative variant on both strands (with strand bias, pos. strand / neg. strand, above 0.2 or below 5) for further consideration. Finally, mutations were retained if detected in more than one of the alignment approaches, and if they reached a minimum frequency of 5% at a minimum of one time point sampled. Further simple and complex small variants were considered from freebayes version 0.9.2147 with similar thresholds, while insertion sequence movements and other mobile element activity was inferred via is mapper version 248 and panISa version 0.1.649, as well as Breseq, as previously described39. All putative variants were verified manually in IGV version 2.750,51. Raw sequencing reads were deposited in the sequence read archive under bioproject PRJNA666769. Population dynamics of lineage-specific dynamics and the resulting Muller plots were inferred manually and are meant strictly as a means of presenting the data. In order to generate these plots, mutations were sorted by frequency (descending for each time point at which the population was sampled). The largest frequency mutations were considered major lineages within which minor frequency mutations occurred. Assuming that a mutation, which arises subsequent to a preexisting mutation (an already differentiated lineage) cannot exceed the frequency of that preexisting mutation at any point, and will fluctuate in frequency with the preexisting one, we assigned mutations to the lineages within each population. While this resolved the majority of high frequency and medium frequency mutations, low-frequency mutations within the Muller plots cannot be placed with high confidence, and are only included for completeness.

To calculate the maximum prophage induction rate we grew E. coli lysogenic clones, starting with the same initial OD600 values: ~0.1 (Bioscreen C system, Oy Growth Curves Ab Ltd), with agitation at 37C in LB medium in the presence or absence of mitomycin C along time (5g/mL)9. The OD600 values were normalized by dividing the ones in the presence of mitomycin C by the ones in the absence of mitomycin C (sampling interval: 30min). The LN of this ratios along time originates a lysis curve, where the maximum slope corresponds to the maximal prophage induction rate for each clone analyzed. We tested evolved clones from mouse A2, H2 and G2 against the ancestral clone which only carries the Nef and the KingRac prophages. We also tested clones of the resident strain that had evolved in the presence of the invader for more than 400 days (these clones were sampled from mouse A2).

To calculate the maximum bacterial growth rate, we grew E. coli lysogenic clones, starting with the same initial OD600 values: ~0.1 (Bioscreen C system, Oy Growth Curves Ab Ltd), with agitation at 37C in LB medium along time using reading intervals of 30min. The LN of the OD600 values along time originates a growth curve, where the maximum slope corresponds to the maximum bacterial growth rate for each clone analyzed.

To test for metabolic differences of the psuK/fruA mutation, growth curves of evolved lysogenic E. coli clones, bearing the Nef and KingRac prophages, with or without the psuK/fruA mutation were performed with the same initial OD600 value (~0.03) for each clone. The clones were grown in glucose (0.4%) minimal medium (MM9-SIGMA) with or without pseudouridine (80 M) and absorbance values were obtained using the Bioscreen C apparatus during 12h.

Frozen stocks of E. coli clones were used to seed tubes with 5mL of liquid LB. These were incubated overnight at 37C under static conditions to assess the formation of cell flocks/clumps, observable to the naked eye, in order to evaluate the formation of cell aggregates. Biofilm was tested according a previously published protocol52 and to evaluate the motility capacity we adapted the protocol from Croze and colleagues53. Briefly, overnight E. coli clonal cultures grown with agitation at 37C in 5mL LB medium supplemented with streptomycin (100ug/mL) were adjusted to the same absorbance and a 3uL volume was dropped on top of soft agar (0.25%). Plates were incubated at 37C and photos were taken at day 1, 2 and 5 post-inoculation to assess swarming motility phenotype.

To estimate the number of generations of E. coli in the mouse gut, we used a previously described protocol to measure the fluorescent intensity of a probe specific to E. coli 23S rRNA (as a measure of ribosomal content) that correlates with the growth rate of the bacterial cells54. We measured the number of generations of the ancestral E. coli clone while colonizing the gut of 2 mice, treated during 24h with streptomycin (5g/L) before gavage, during 25 days.

Plasmid DNA was extracted from overnight cultures using a Plasmid Mini Kit (Qiagen), according to the manufacturers guidelines. Specific primers for the amplification of repA and repB genes, were used to determine the frequency of the 68935bp (~69Kb) and 108557bp (~109Kb) plasmids, respectively, in the invader E. coli population.

The primers used for repA gene were:

repA-Forward: 5-CAGTCCCCTAAAGAATCGCCCC-3 and repA-Reverse: 5-TGACCAGGAGCGGCACAATCGC-3.

For repB the primer sequences were:

repB-Forward: 5-GTGGATAAGTCGTCCGGTGAGC-3 and repB-Reverse: 5-GTTCAAACAGGCGGGGATCGGC3.

PCR amplification of plasmid-specific genes was performed in 12 isolated random clones from mouse A2 at days 104 and 493. PCR reactions were performed in a total volume of 25L, containing 1L of plasmid DNA, 1X Taq polymerase buffer, 200M dNTPs, 0.2M of each primer and 1.25U Taq polymerase. PCR reaction conditions: 95C for 3min, followed by 35 cycles of 95C for 30s, 65C for 30s and 72C for 30s, finalizing with 5min at 72C. DNA was visualized on a 2% agarose gel stained with GelRed and run at 160V for 60min.

P1 transduction was used to construct a dgoR mutant (dgoR KO). This KO strain was created by replacing the wild-type dgoR in the invader ancestral YFP-expressing genetic background by the respective knock-out from the KEIO collection, strain JW562755, in which the dgoR sequence is replaced by a kanamycin resistance cassette. The presence of the cassette was confirmed by PCR using primers dgoK-F: GCGATGTAGCGAGCTGTC, and yidX-R: GGGAATAAACCGGCAGCC. PCR reactions were performed in a total volume of 25L, containing 1L of DNA, 1X Taq polymerase buffer, 200M dNTPs, 0.2M of each primer and 1.25U Taq polymerase. PCR reaction conditions: 95C for 3min, followed by 35 cycles of 95C for 30s, 65C for 30s and 72C for 30s, finalizing with 5min at 72C. DNA was visualized in a 2% agarose gel stained with GelRed and run at 160V for 60min.

The Qiagen RNeasy Mini Kit was used for RNA extraction. RNA concentration and quality were evaluated in the Nanodrop 2000 and by gel-electrophoresis. DNase treatment was performed with the RQ1 DNase (Promega) by adding 0.5l of DNase to 1g of RNA and 1l buffer in a final volume of 15ul, followed by incubation 30min at 37C. Afterwards, 1ul of stop solution was added and incubation for 15min at 65C was performed to inactivate the DNase. As a control for complete DNA digest a PCR was performed on the reactions including positive controls. Reverse transcription was performed with M-MLV RT[-H] (Promega) by mixing 1g of RNA with 0.5l random primers (Promega) and nuclease free water to a volume of 15l, incubation at 70C for 5min and a quick cool down on ice. Afterwards the reverse transcription was accomplished by adding 5l of RT buffer, 0.5l RT enzyme and 2l dNTP mix, followed by incubation for 10min at 25C, 50min at 50C and 10min at 70C. The resulting cDNA was diluted 100-fold in nuclease free water before changes in gene expression were detected using the The QuantStudio 7Flex (Applied Biosystems) with iTaq Universal SYBR Green Supermix (BioRad) and the following cycling protocol: Hold stage: 2min at 50C, 10min at 95C. PCR stage (40 cycles): 15s at 95C, 30s at 58C, 30s at 60C. Melt curve stage: 15s at 95C, 1min at 50C then increments of 0.05C/s until 95C. Melt curve analysis was performed to verify product homogeneity. All reactions included six biological and three technical replicates for each sample. A relative quantification method of analysis with normalization against the endogenous control rrsA and employing the primer specific efficiencies was used according to the Pfaffl method (add reference). The primers used were designed with PrimerQuest (idt). The used primer sequences were: psuK - TGCGTTAGCAGCGATTGA, AATTTACGCCTGGTGGAGTAG; arcA - GATTCATGGTACGGGACAGTAG, CCGTGACAACGAAGTCGATAA; yjtD - CGCACATGGATCTGGTGATA, GGCGTGGCGTAGTAATGATA and rrsR - GTCAGCTCGTGTTGTGAAATG, CCCACCTTCCTCCAGTTTATC.

Correlation between microbiota diversity measures and E. coli loads (CFU) or persistence (1-presence or 0-absence) was performed in R using the statistical package rmcorr (version 0.5.2)56 and lme4 (version 1.1-10)57, respectively. The rate of accumulation of new ISs in vivo was compared using Wilcoxon paired signed ranked test for expected and observed insertions, while the rate of selective sweeps correlation was performed using the Spearman Correlation test. Selective sweeps were taken to be mutations or HGT events that reached>95% frequency in the population and kept high frequency until the end of the colonization. Statistical analysis of prophage induction as well as biofilm levels was performed using the Mann-Whitney test in GraphPad Prism (version 8.4.3). A single sample T-Test was used test if the growth rate of evolved invader clones deviates from the mean of the ancestral. A Wilcoxon rank sum test with continuity correction was used to compare the relative expression levels of the evolved clones with the ancestral. P values of<0.05 were considered significant.

Pearson correlation tests between the frequency and the change in frequency of a mutation were performed to search for evidence of negative frequency-dependent selection. These were conducted for every mutation that showed parallelism and for each mouse, provided that the mutation was detected in at least four time points. The correlations were calculated in R with cor.test, used for the association between paired samples.

Linear mixed models (R package nlme, v3.158) were used to analyze the temporal dynamics of the dgoR KO mutant frequency in the presence or absence of the resident E. coli. The frequency of the dgoR KO mutant was log10 transformed to meet the assumptions of parametric statistics.

Sample size in animal experiments was chosen according to institutional directives and in accordance with the guiding principles underpinning humane use of animals in scientific research. No data were excluded from the analysis. The experiments were randomized with animals being assigned arbitrarily to each experiment. The investigators were not blind towards the animal experiments.

The following statistics are designed to infer the prevalent type of selection from time-resolved mutant frequency data. Specifically, we use such data to discriminate adaptive evolution under directional selection, which can take place by periodic sweeps or by clonal interference, and adaptation under diversifying selection (to be defined below).

We use two test statistics for frequency trajectories of established mutants (i.e., mutants that have overcome genetic drift):

the frequency propagator G(x), defined as the probability that a trajectory reaches frequency x,

the sojourn time T(x), defined as the time between origination at a threshold frequency x0 and the first occurrence at frequency x, averaged over all trajectories reaching frequency x. In terms of the underlying coalescent, T(x) is the time to the last common ancestor for a genetic clade of frequency x.

These observables discriminate the following modes of adaptive evolution:

Periodic selective sweeps under uniform directional selection. This mode is characteristic of simple adaptive processes in small populations or populations with low mutational inputs, where adaptive mutations are rare enough to fix independently59,60,61. Almost all established adaptive mutations reach fixation, and sojourn times to an intermediate frequency x>x0 are of order of their inverse selection coefficient (up to logarithmic corrections):

$${{{{{rm{G}}}}}}left(xright)approx 1,{{{{{rm{T}}}}}}left(xright)sim frac{1}{s}.$$

(1)

Clonal interference under uniform directional selection. This mode occurs in asexual populations when adaptive mutations become frequent enough to interfere with one another59,60,61. Only a fraction of the established adaptive mutations reaches fixation; sojourn times to intermediate frequencies are set by a global coalescence rate (widetilde{sigma }) that is higher than the typical selection coefficient of individual mutations62:

$${{{{{rm{G}}}}}}left(xright) < 1,{{{{{rm{T}}}}}}left(xright)sim frac{1}{widetilde{sigma}}.$$

(2)

Details of these dynamics depend on the spectrum of selection coefficients and on the overall mutation rate, which set the strength of clonal interference. For moderate interference, where a few concurrent beneficial mutations compete for fixation, we expect a roughly exponential drop of the frequency propagator, (Gleft(xright)sim {{exp }}left(-lambda xright)), reflecting the probability that a trajectory reaches frequency x without interference by a stronger competing clade. Moderate interference generates an effective neutrality for weaker beneficial mutations and at higher frequencies63. This regime has been mapped for influenza64. In the asymptotic regime of a travelling fitness wave, where many beneficial mutations are simultaneously present, the fate of a mutation is settled in the range of small frequencies; that is, at the tip of the wave65. In this regime, emergent neutrality affects the vast majority of beneficial mutations and most of the frequency regime66. Hence, the frequency propagator rapidly drops to its asymptotic value (Gleft(x=1right)ll 1.)

Adaptation under diversifying selection. More complex selection scenarios involve selection within and between ecotypes, i.e., subpopulations occupying distinct ecological niches67,68. An important factor generating niches and ecotypes is the differential use of food and other environmental resources. In this mode, ecotype-specific, conditionally beneficial mutations reach intermediate frequencies after a time given by their within-ecotype selection coefficients, but fixation can be slowed down or suppressed by diversifying (negative frequency-dependent) cross-ecotype selection18,

$${{{{{rm{G}}}}}}left(xright)approx 1,{{{{{rm{T}}}}}}left(xright)sim frac{1}{s},left(xlesssim ,frac{1}{2}right)$$

(3)

$${{{{{rm{G}}}}}}left(xright) < 1,{{{{{rm{T}}}}}}left(xright)gg frac{1}{s}left(xto 1right).$$

(4)

The details depend on the details of the eco-evolutionary model (synergistic vs. antagonistic interactions, carrying capacities, amount of resource competition vs. explicitly frequency-dependent selection). In a model with directional selection within ecotypes, conditionally beneficial mutations rapidly fix within ecotypes, but lead only to finite shifts of the ecotype frequencies. In the simplest case, the resulting dynamics of ecotype frequencies is diffusive, resulting in an effectively neutral turnover of ecotypes18. Given negative frequency-dependent selection between ecotypes, fixations become even rarer and can be completely suppressed; that is, ecotypes can become stable on the time scales of observation. The separation of time and selection scales between intra- and cross-ecotype frequency changes is expected to be a robust feature of ecotype-dependent selection: sojourn of adaptive alleles to intermediate frequencies is fast, fixation is slower and rarer. In other words, ecotype-dependent selection is characterized by two regimes of coalescence times T(x).

Frequency propagators and the coalescence time spectra expected under these evolutionary modes are qualitatively sketched in Supplementary Fig.11. For periodic sweeps under directional selection (dark green, left column), G(x) depends weakly on x and T(x) is set by rapid sweeps for all x. For clonal interference under directional selection (green, center column), G(x) decreases substantially with increasing x and T(x) becomes uniformly shorter. Under negative frequency-dependent selection (brown, right column), G(x) decreases substantially with increasing x, while T(x) substantially increases for large x and diverges in case of strong frequency-dependent selection generating stable ecotypes (dashed lines). (see Supplementary Fig.11 for the results of simulations assuming a model of direction selection or assuming a resource competition model where ecotype formation occurs31.

This test is based on qualitative characteristics of the functions G(x), T(x) and does not depend on details of the evolutionary process. We evaluate G(x) and T(x) for host-specific families of frequency trajectories; sojourn times are counted from an initial frequency x0=0.01. Origination times at this frequency are inferred by backward extrapolation of the first observed trajectory segment; the reported results are robust under variations of the threshold x0 and the extrapolation procedure. We then compute two summary statistics: the probability (p) that a mutation established at an intermediate frequency xm reaches near-fixation at a frequency xf,

$$p=frac{{{{{{rm{G}}}}}}({x}_{f})}{{{{{{rm{G}}}}}}({x}_{m})},$$

(5)

and the corresponding fraction of sojourn times,

$$tau=,frac{{{{{{rm{T}}}}}}({x}_{f})}{{{{{{rm{T}}}}}}({x}_{m})}.$$

(6)

Here we use xm=0.3 and xf=0.95 to limit the uncertainties of empirical trajectories at low and high frequency; however, the selection test is robust under variation of these frequencies. We find evidence for different modes of evolution:

The long-term frequency trajectories of mice B2, D2 and E2 are consistent with predominantly frequency-dependent selection (Fig.2, Fig.4ac). The propagator G(x) is a strongly decreasing function of x, resulting in fixation probabilities (p)<0.5. Sojourn times T(x) show two regimes with a stronger increase in the frequency range x>0.6, as measured by time ratios >3.

The trajectories of mice A2, G2, and I2 show a signature of recurrent selective sweeps and clonal interference under uniform directional selection (Fig.4ac). The propagator G(x) is a decreasing function of x, resulting in fixation probabilities (p=0.2-0.8), depending on the strength of clonal interference. Fixation times are short, giving time ratios (tau lesssim 2).

The shorter trajectory of mouse H2 signals periodic sweeps under uniform directional selection (Fig.3, Fig.4ac). The origination rate of mutations is lower than in the longer trajectories, and G(x) shows a weak decrease with (p=1.) Sojourn times T(x) are short and grow uniformly with x, resulting in a time ratio =2.25. This pattern is expected under directional selection in the low mutation regime: (Tleft(xright)={{log }}left[x/(1-x)right]/{s}) for individual mutations with a uniform selection coefficient s, leading to =2.0 for xm=0.3 and xf=0.95 (this value is marked as a dashed line in Fig.4c).

The trajectories of non-mutator lines in the long-term in vitro evolution experiment of Good et al1, evaluated over the first 7500 generations, show an overall signal of clonal interference under uniform directional selection (Fig.4c, Supplementary Fig.12). The frequency propagators G(x) are strongly decreasing functions of x and sojourn times T(x) grow uniformly with x. We find (p=0.2-0.8) and (tau lesssim 2), similar to the pattern in mice A2, G2, and I2.

The code for selection tests from the mutation frequency trajectories can be found in theSupplementary Information file.

Further information on research design is available in theNature Research Reporting Summary linked to this article.

Continued here:

Two modes of evolution shape bacterial strain diversity in the mammalian gut for thousands of generations - Nature.com

Gundam Evolution apparently features secret MVP intros, complete with a fake out to draw maximum salt from players.

Fans have begun to discover these secret clips, which override your currently equipped MVP choice- not unlike Sombras Play of the Game intro from Overwatch.

Honestly the MVP fakeouts are great and I love the references they put in the animations, hope it doesnt get taken away, writes Twitter user SayaDoesStuff.

Even in the MVP screens, we aint safe from a Barbatos airdrop, writes YouTube user animegx45, warning people about the likelihood of being jumped by the Barbatos Gundam.

While no official explanation has been given for them, the leading theory is that it requires two Gundam Evolution players to score extremely close to each other- earning you the fake out MVP intro.

Some speculate that theyre tied to specific pairings of mobile suits- but given the Turn A Gundam has nothing to do with the DOM Trooper, its less likely compared to just being about closely-tied scores.

Weve reached out to Bandai Namco Entertainment about the conditions of the secret fake out MVPs in Gundam Evolution, and will update with their statement.

Many of these are also incredibly fun references to the Gundam series overall, too: the DOM Troopers perform a Jet Stream attack, complete with two additional DOMs to support you in taking down your opponent.

Some of the lesser mobile suits are sure to be satisfying for players too, such as the Guntanks which features it running over its adversaries before pointing its main guns to their head.

Considering that Gundam Evolution is built around the idea of esports, the idea of having fake outs like this is sure to be great for the community- just the fact that so many people are discussing how hype they are is a good sign for the community.

Continued here:

Gundam Evolution Has Secret Fake Out MVP Intros And The Internet Loves Them - GamerBraves

You can put lipstick on a pig, but its still a pig. Thats how the saying goes, and it only seems like yesterday we were in the era of green and black screens when the arrival of the internet triggered record levels of investment in the technology market searching for the definitive killer app with a modern look and feel interface for users.

Looking back at the user experiences of past technology systems compared to today can fill you both with nostalgia and horror, passing through relatively short-lived technology innovations of client/server and thin client along the way. Spending vast amounts of money just to make something look good without the underlying functionality was and still is fools gold, as well discover.

Early origins back to the 80s

The battle for desktop supremacy and the user experience has its origins in the early 1980s and the Apple vs Microsoft wars. Then the user experience was tightly integrated into the operating system and, in Apples case, the hardware, hence the focus was more on overall functionality than just look and feel.

For those who appreciate the beauty of innovation, the idea was encapsulated in the much-quoted Steve Jobs principle of design: Youve got to start with the customer experience and work back towards the technology not the other way around. This ensured Apple in many ways had the jump on Microsoft regarding delivery of the end-user experience, although the opportunistic and entrepreneurial flair of Bill Gates ensured Microsoft Windows ultimately won and monopolised the Battle of the Desktop. The rest, as we know, is history.

Technology should exist to make our lives easier and for the better. Accessibility and enabling capability to allow us to eschew mundane repetitive activity and maximise our time is the very essence of the digital experience. Great technology-enabled experiences always empower the user.

SaaS cloud applications continue to make quantum leaps in an era of design thinking where we are constantly reinventing work through the employee experience. This is done with the knowledge that everything now is about creating immersive digital experiences for customers and employees alike, which cross an enterprise architecture and the functional silos found in organisations and become reflected in ERP modular system design.

Dawn of the SaaS cloud era the power of the user experience

At the start of the SaaS cloud era for enterprise applications, circa 2011-2019, the clear industry leader was Workday. The Pleasanton, California-based brand undertook a considerable amount of investment to ensure its human capital management (HCM) offering was highly intuitive, easy to use and provided an attractive experience.

Adopting the belief that sex sells, Workday had the jump on Oracle in terms of look and feel, and quickly used this to capture market share and build product adoption momentum. Just to keep things balanced, one should note that SAP were nowhere to be seen, despite the siloed HCM functionality within the ERP giants moderately successful stand-alone offering, SuccessFactors.

The SaaS cloud era saw the user interface look and feel in the buyers mind as the superior requirement over underlying system functionality. Organisation buyers were, surprisingly or not, prepared to spend significant sums of money on something that looked pretty. After all, comparing early SaaS applications accessibility and usability against on-premise applications was an easy win, and this became the major recurring theme in the market.

Subsequently, all vendors increased R&D expenditure and focussed on the user experience, with simplification and ease of use being the constant drivers.

The extremes vendors went to was significant, like the example of retina eye scanning, recording how a user sees the screen and accesses functionality, then using the outcomes to reconfigure the system accordingly.

However, even with all the advances in user experience, the platform vendors were still locked into a suite of silo applications. People, regardless of whether being a customer or employee, knowingly and unknowingly touch many front of house and middle office systems to access a service.

Changing the conversation systems of experience

With technology innovation moving so fast, the days of debating the field position on a screen, list of values, and how pretty the web browser screen is, for the true pioneers of the experience economy, are now far behind us. The buying criteria of early SaaS systems is no longer the sole overriding factor.

The dawn of the #experienceeconomy has seen the rise of the experience platforms, first touted around 2019, with the likes of Salesforce and ServiceNow leading the charge and taking the game to the ERP vendors.

Whilst such systems can easily co-exist, naturally the competitive nature of the industry has seen these platforms perceived as taking ERP market share. Experience platforms are not ERP systems, and whilst there are some grey areas, on the whole they can digitalise work in the way work is actually executed inside an organisation, and not necessarily reflecting the out of the box, siloed functional SaaS processes.

Equally the industry approach has evolved allowing multi-channel accessibility, noting most users would rather access technology via their mobile devices. There exists now a focus on creating holistic systems of experience, where personalised services are accessible based upon role and individual whilst residing and leveraging standardised business processes as and when necessary.

To combat this, the ERP vendors are having to move into the new era, most notably Oracles announcement of OracleME earlier this year, which in my view is a direct response to the advance of pure experience platform vendors. It does demonstrate that the large ERP vendors are not immune to market forces; in this case Oracle just so happens to be the first to positively respond.

Drivers of #experienceeconomy

The global pandemic has accelerated the adoption of digital technology, and whilst the public sector appears to remain in the dark ages regarding the implementation of back-office systems, those in the commercial private sector that did not embrace or could not change fast enough simply went out of business, unable to weather the storm.

With the technology industry always taking note of consumer behaviour and demand, the following factors are driving continuous investment in creating experiences:

Consumer need for greater user adoption systems must be intuitive and easy to use by default.

Simplification of process recognising many operational business processes cut across an organisation and that people do not work in operational silos.

Continuous need for insight the use of real-time data analytics to drive the experience is key.

The ability to deliver flexible, intuitive, easy to use applications that reflect the way people engage and deliver a service by creating data driven immersive experiences accessible at a given point in time continues to attract significant investment monies.

Where are we heading?

The divide between humans and machines comes ever closer with the advancement of technology, specifically with artificial intelligence and machine learning. Therefore, the natural question to ask is, just where is all this heading?

Looking now at the advances of technology in terms of virtual reality and avatars, and the predicted greater adoption of Google Glass, what we are seeing is the creation of an even more accessible and immersive experience.

Welcome to the #experienceeconomy its not going away, folks!

Mark Sweeny, founder, de Novo Solutions

See the article here:

From lipstick on a pig to the experience economy, the evolution of UX ERP Today - ERP Today

Humans all share a common African ancestry, making African history everyones history. Yet little is known about the genetic evolution of people living on the continent in the distant past.

Thanks to advances in genome sequencing technology, scientists are now able to compare the DNA of people alive today with DNA extracted from very old skeletons, giving us a unique snapshot of life in Africa from many thousands of years ago.

In the field of human genetics, the story of Mother Eve is a familiar one. It describes how all living humans descend from one woman who lived in Africa 200,000 to 300,000 years ago.

Evidence comes from studies of mitochondrial DNA (mtDNA) a segment of genetic material found in the human cell. Amongst other things, it permits the study of relatedness in populations. Because only mothers pass it down, it reveals the direct evolutionary line between a person living today and their most distant female ancestor.

But like most simple stories, the tale of mitochondrial Eve is neither entirely accurate nor complete. While scientists agree that the dawn of humans did indeed occur in Africa, Eve would have been one of many human females living at the time, and she would not have been the first.

Unfortunately, the reality is that mtDNA gives us limited insight into the timelines, or the patterns, of population spread and dispersal.

Molecular biologist Dr Mateja Hajdinjak explains the significance of this knowledge gap. African population history has shaped the world we all live in, so until we can reconstruct the events from Africas past, going back thousands of years, we cant fully understand how modern humans emerged.

Dr Hajdinjak is the post-doctoral researcher on the ORIGIN project, an EU-funded research initiative based at the Francis Crick Institute in London, UK that is analyzing DNA from human remains found in archaeological sites in Africa.

The goal of ORIGIN is to reconstruct African prehistory using ancient DNA analysis.

The information yielded from these DNA samples is being studied alongside the findings of the projects archaeologists, palaeontologists and museum curators.

Dr Hajdinjak is among a growing number of researchers working hard to fill in the historical blanks by moving beyond analysis of mtDNA to use the latest techniques in whole genome sequencing. This allows researchers to compare the DNA of people living today with DNA extracted from very old skeletons.

One of our basic questions is, how can we use ancient DNA to reconstruct past population migrations within Africa and between Africa and other parts of the world? said Dr Hajdinjak.

She adds that little is known about the past genomic landscape across Africa, as much of the genetic change occurred on the continent when some groups shifted from their hunter-gatherer way of life to become agriculturalists between 3,000 and 7,000 years ago.

By comparing past genomes, we can see how different human groups are interconnected, and how migrations happened at different times in history. Migrations allow people to mix and reproduce with new groups, which changes human biology over time.

A lot is already known about ancient European history thanks to modern sequencing techniques, but ancient DNA studies of African samples have lagged behind. The reason for this is that DNA degrades over time, and especially in the hot and humid climates that prevail in Africa.

However, thanks to cutting-edge genome enrichment tools that allow DNA from the tiniest fragments of bone or teeth to be extracted and then amplified, scientists are starting to make good progress sequencing ancient DNA from Africa too.

By studying the data in this way, the researchers are starting to reconstruct events from the distant past and to probe the relationships that emerged between different African populations.

The aim of ORIGIN is not simply to satisfy our natural curiosity about where we came from, but also to unravel the timeline of our genetic evolution, and to use this information to predict how we might evolve into the future.

Some genetic mutations will have been instantly beneficial to our African ancestors, and will have persisted through the gene pool to this day, thousands of years after they first arose. A key example is lactase persistence the ability to digest milk into adulthood.

Milk and milk products are a valuable source of energy, yet the default ancestral state is lactose intolerance. For adults living in early African farming communities, the ability to convert milk from their herds into glucose may have given them an evolutionary advantage over their lactose intolerant neighbors.

Another genetic variant that would have boosted human survival when it first emerged is the sickle cell mutation. This genetic variant confers a degree of protection against malaria.

However, the mutation is something of a double-edged sword, as it is also responsible for sickle cell disease a serious and life-long condition that is prevalent in parts of Africa to this day.

It would be very important to reconstruct how sickle cell mutations first appeared and spread, said Dr Pontus Skoglund, supervisor of the ORIGIN project.

By understanding when mutations happened and how they spread, we can better understand how humans respond to evolutionary challenges, said Skoglund.

Researchers involved in the EU-backed AfricanNeo project are particularly intrigued by early farming practices in Africa. They are comparing samples of ancient DNA with contemporary DNA to refine their understanding of when African populations started migrating across their continent.

These migrations had a huge impact on the genetic mixing of groups, but the researchers are finding that this expansion was a complex series of events that cannot be encapsulated into a neat mitochondrial Eve-style narrative.

Expansion was not uniform across the continent, said Associate Professor Carina Schlebusch. She is an evolutionary biologist at the University of Uppsala in Sweden and principal investigator of the project.

Some hunter-gatherer groups were replaced by farmers, she said, referring to the likelihood that conflict would have arisen between populations wanting to occupy the same land, and that farmers would have enjoyed a competitive edge over hunter gatherers. Other groups interacted and exchanged genes, and others still remained isolated for far longer than you might expect.

Its clear why we should all care about these complex events from Africas distant past, according to Dr Schlebusch.

History tends to repeat itself, she said. These past migratory events may well play a role in how we behave in our future. For example, climate change means there is likely to be more pressures on people who are forced to leave their homes. There is a chance there will be more conflicts between populations and that some minority groups will be replaced.

The more we learn about our history, she said. The more we can predict how things will work out in the future.

The research in this article was funded via the EUs European Research Council and the Marie Skodowska-Curie Actions (MSCA). The article was originally published on Horizon, the EU Research & Innovation magazine.

Read the original here:

How prehistoric DNA is helping to unlock the secrets of human evolution - EL PAS USA

In 1996, Sara Chesterman was 24, an architecture student and engaged in contemporary dance when she had an accident resulting in quadriplegia paralysis from the collarbone down, partial paralysis of her arms and complete paralysis of her fingers. She continued dancing and performing, completed her fine arts degree in painting and drawing (COFA, now UNSW Art and Design) and taught interior architecture for six years (UNSW). In the process of living her life and raising her son, born in 2009, she has worked to rethink the design of many everyday objects and the spaces of her home. She spoke with Maryam Gusheh and Catherine Murphy about the evolution of these spaces.

Sara Chesterman used cardboard templates to test what was required to enable her to enjoy cooking in her kitchen while interacting with her son.

The alterations to my home have always been collaborative. The architectural expertise of my brother and father, John and David Chesterman, has been invaluable in the major changes we have made to the fabric of the house. Spatial experiments with my partner have also performed a key role; we have constantly played with and tested old furniture and bits and pieces to create a space that supported comfort and equality of social interaction. Its been ongoing, evolving.

The original house was a two-bedroom semi in Bondi. We bought it eight months after my injury, because it was a level block. At the time, there was nothing I could buy or rent that immediately met my needs. Changes had to be made quite quickly. We did the first renovation before I moved in in 1996 and another one three decades later in 2018.

The initial move was to add a pavilion with a bedroom and bathroom at the rear of the block, connected by a breezeway through a garden courtyard to the main house. The division allowed the possibility of co-living, and a series of design changes accommodated the proportions and operations of my lightweight, manual wheelchair lowered work surfaces, a compact kitchen so that I could push off nearby surfaces without having to dirty my hands on the wheels, and level access to on-site car parking. At that time, I drove a car modified with hand controls.

The connection to and the experience of a garden are really important to me. My new pavilion had large glass sliding doors that opened directly to the garden and swing doors wide enough to move my bed out onto the breezeway. In 1998, I met my partner. He helped develop the garden, planting trees that attracted birds to my window and sinking a bath into the ground to create a pond. The pond is a home to frogs and casts moving light reflections onto the ceiling above my bed. He put up mirrors to enhance the feeling of space and enable me to see into spaces behind me when I was immobilized in bed. The view to the garden to the east, and high windows in the north and west walls, mean that light moves through the room, creating a strong connection to changing seasons and the passage of time. I have found these connections vital during long periods of bed-rest that can sometimes last months at a time.

The rear pavilion also allowed for privacy. I was concerned about the impact of my care on others. I didnt want my carers late-night and early-morning routines to disturb the household. So, we provided a second entry via the courtyard for greater privacy. The division between the front and back also meant that I could have flatmates, as a potential income source, or provide live-in carer accommodation.

By 2002, six years after my accident, I had sustained a severe shoulder injury that meant I could no longer drive and needed a much larger, motorized wheelchair. This gave me freedom to travel on the footpath, safely use public transport and visit local parks and beaches. But the larger wheelchair wasnt well suited to the interior of my home I could not easily manoeuvre around inside and I couldnt get into or use the kitchen. I could no longer participate in the full life of the house.

There were other problems, too. The weather would batter the breezeway and I was always freezing. My bed couldnt be moved from the pavilion into the living spaces. The swing doors were difficult to operate. At one point, we took the door right off the kitchen it was better to live without it and to be cold than to deal with the constant difficulty and shoulder pain of opening and closing. So, in 2018 we did the next renovation.

The current house basically follows the old plan we found that the rear pavilion strategy worked pretty well. But the renovations allowed us to clarify the ad hoc changes that had been made in response to my changing needs. It also added a bedroom for my son, separated from the rentable portion of the house.

Wider openings that are easy to open and close, and automated curtains that provide fluid thresholds and audio privacy, are central to the success of the new works. We can easily roll my bed through most spaces of the house so I can participate in social activities when on bed-rest. My partner put our bath on wheels. I can use the bedroom hoist to transfer into the bath and then easily choose where I wish to be baths in the garden are magic at night!

The long-term expense of heating and cooling were considered, as I have completely lost the ability to control my body temperature. In hot weather I get fevers, in winter my body temperature can drop and take up to 24 hours to restabilize. When this happens, the temperature of the room has to change beyond the comfort zone of other people. We added solar panels and created the possibility of rooms with distinct environmental qualities.

We also included multiple new kitchens: a small, independent kitchenette for the carers, close to my bedroom to strengthen the separation and efficiency of care; another kitchenette for the front dwelling to enhance its autonomy; and a bigger, functional kitchen where I can again cook.

Off-the-shelf accessible kitchens are not designed to accommodate large motorized wheelchairs. I couldnt find an adjustable-height kitchen bench that I could use or a sink that I could get under. And having not cooked for 15 years, I had little insight into what I was capable of doing. So, we made many cardboard templates to test and develop what was needed. Core to the design was the understanding that cooking, for me, would be an interdependent activity. The transformation has been incredible. Being able to cook makes me feel like I am able to fully participate in family life cooking dinner while overseeing my son doing homework is such a great thing. If I were an able-bodied mum, maybe Id be resenting it, but Im really enjoying it its something that I can do while interacting with him.

After the new alterations, my dad moved into the front section of the house. He also needs some support now and we are able to share my carer support. So, the structure of the house has, in effect, helped me to provide carers with longer shifts and more stable employment, while living independently but in close proximity to my father. With my sister living across the road, we can ensure he is cared for safely and happily. This is such a relief for our family. It would be a relief for anyone, really.

I do feel like we have evolved some key principles that could serve as a model for retrofitting other homes, so that the house is better for everyone. Levels of privacy reinforced through different types of operable closures and dual entries. A green space core to the house that brings the external environment to a person who may be housebound for long periods. The bedroom as a multi-use space a highly functional workspace for carers and a place where the more intangible qualities of architecture (space and light) can support mental wellbeing. The possibility of interconnected dwellings for multi-generational living, casual support, live-in paid support or shared care arrangements.

Once these principles are established and combined with flexible space and wide openings, bespoke elements can be integrated and modified to accommodate a persons needs as they change over time, without major alteration to the fabric of the house.

At the outset of this interview, you asked me if I think architectural approaches can support or enhance human capabilities and contribute to my quality of life. The evolution of the home has made me realize that architecture is not only a necessary support, but absolutely fundamental.

Continued here:

Cardboard templates and the evolution of a home - Architecture AU

Image credit: Rick Bolin, via Flickr (cropped).

Theoretical physicistSabine Hossenfelderrecently posted a very informative video asking Did the Big Bang happen? She explains why alternative theories to the Big Bang model fail to better explain the cosmological data. She also unintentionally affirms the fine-tuning argument for design in the universe.

Hossenfelder begins by summarizing the evidence for Big Bang cosmology based on Einsteins theory of relativity and the observed expansion of space. She also explains why the exact details of the early universe remain a mystery. Cosmologists have a limited understanding of the physics of this time when the energy of particles exceeded what the Large Hadron Collider at CERN could generate. In addition, elucidating the dynamics of the universes earliest epoch requires a theory of quantum gravity, which does not currently exist.

Even given these limitations, the Big Bang theory represents the best model since it is founded on general relativity, and Einsteins theory is supported by numerous pieces of observational evidence such as the bending of light around stars. In addition, the standard model (i.e., Big Bang model with a cosmological constant and cold dark matter) predicts many observations such as the Cosmic Microwave Background and the galactic filaments using simple initial conditions. The universes initial state is assumed to approximate a uniform distribution of mass-energy.

The standard model thus provides a simple explanation for the current state of the universe since it requires few variables. These include the variables in the relatively simple equations for the expansion of the universe, the initial mass-energy density, and the initial expansion rate.

Hossenfelder then provides a deeply insightful exposition on the inferiority of other models. All other models rely on different equations for the dynamics of the early universe. But these equations can only generate our current state by choosingfar more complex initial conditions:

Einsteins equations together with their initial values in the early universe provide a simple explanation for the observations we make today. When I say simple, I mean simple in a quantitative way you need few numbers to specify. If you used a different equation, then the initial state would be more difficult. Youd need to put in more numbers. And the theory wouldnt explain as much.

The key problem is that nearly any set of equations could yield the current state of the universe with the right choice of initial conditions. But neither the theorys underlying equations nor the initial conditions can be independently verified. And the alternative theories provide no additional knowledge. Hossenfeldersummarizes as follows:

And then they also need a different initial state, so you might no longer find a Big Bang. As I said earlier, you can always do this, because for any evolution law there will be some initial state that will give you the right prediction for today. The problem is that this makes a simple explanation more complicated, so these theories are not scientifically justifiable. They dont improve the explanatory power of the standard cosmological model. Another way to put it is that all those complicated ideas for how the universe began are unnecessary to explain what we observe.

Hossenfelder lists several theories that fall under her critique including Penroses cyclic cosmology, the ekpyrotic universe that postulates colliding membranes, and the no-boundary proposal by Jim Hartle and Stephen Hawking. Stephen Meyer also critiqued these theories in his bookReturn of the God Hypothesis. But Meyer came to starkly different conclusions.

Hossenfelder concludes that we are facing the limits of science itself. And the question of the universes origin well never be able to answer. In contrast, Meyer argues that the evidence for a beginning and the required fine tuning of the universe to support life point to a mind behind our world. The fact that all alternative cosmological theories require highly specific initial conditions to explain our present life-friendly universe only reinforces the fine-tuning argument and by extension the God Hypothesis.

See the rest here:

Deficiency of Alternative Models to the Big Bang - Discovery Institute

NEW YORK September 9, 2022 Texworld NYC and Apparel Sourcing NYC return to the Javits Center in New York City with focus on transformation and invigoration.

Reflecting the ever-changing climate of the globally connected industry, Texworld Evolution New York City serves as a nexus for growth and the future of the largest sourcing event on the East Coast.

The co-located event composed of Texworld NYC, Apparel Sourcing NYC, and Global Footwear Sourcing is set to bring attendees 3 full days of global sourcing, networking, education, workshops, curated trends and more. With a focus on expanding fashion textile, component, and apparel sourcing, the evolved and elevated show floor will feature multiple new product and service categories including finished footwear and design studios as well as exciting new partnerships to be announced soon.In addition to the events mainstay features, the Lenzing Seminar Series, Textile Talks, and Texworld Trend Showcase, visitors can discover even more inspiration and innovation through live interactive workshops, informative demonstrations, and experiential activations. The event will also include enhanced networking events and enlarged meeting areas on the show floor to create a more inclusive, community building space for both attendees and exhibitors.

Registration for attendees is set to open next week. The event will be held in New York City at the Javits Convention Center, January 31 February 2, 2023. For more detailed information, please visit us online:

http://www.TexworldNewYorkCity.com

http://www.ApparelSourcingNewYorkCity.com

Posted: September 26, 2022

Source: The Messe Frankfurt Group

Originally posted here:

Texworld Evolution New York City Winter 2023 Edition To Bring Brand New Product Categories And Exciting Partnerships - Textile World Magazine