A machine learning approach to define antimalarial drug action from heterogeneous cell-based screens – Science Advances

Abstract

Drug resistance threatens the effective prevention and treatment of an ever-increasing range of human infections. This highlights an urgent need for new and improved drugs with novel mechanisms of action to avoid cross-resistance. Current cell-based drug screens are, however, restricted to binary live/dead readouts with no provision for mechanism of action prediction. Machine learning methods are increasingly being used to improve information extraction from imaging data. These methods, however, work poorly with heterogeneous cellular phenotypes and generally require time-consuming human-led training. We have developed a semi-supervised machine learning approach, combining human- and machine-labeled training data from mixed human malaria parasite cultures. Designed for high-throughput and high-resolution screening, our semi-supervised approach is robust to natural parasite morphological heterogeneity and correctly orders parasite developmental stages. Our approach also reproducibly detects and clusters drug-induced morphological outliers by mechanism of action, demonstrating the potential power of machine learning for accelerating cell-based drug discovery.

Cell-based screens have substantially advanced our ability to find new drugs (1). However, most screens are unable to predict the mechanism of action (MoA) of identified hits, necessitating years of follow-up after discovery. In addition, even the most complex screens frequently find hits against cellular processes that are already targeted (2). Limitations in finding new targets are becoming especially important in the face of rising antimicrobial resistance across bacterial and parasitic infections. This rise in resistance is driving increasing demand for screens that can intuitively find new antimicrobials with novel MoAs. Demand for innovation in drug discovery is exemplified in efforts on targeting Plasmodium falciparum, the parasite that causes malaria. Malaria continues to be a leading cause of childhood mortality, killing nearly half a million children each year (3). Drug resistance has emerged to every major antimalarial to date including rapidly emerging resistance to frontline artemisinin-based combination therapies (4). While there is a healthy pipeline of developmental antimalarials, many target common processes (5) and may therefore fail quickly because of prevalent cross-resistance. Thus, solutions are urgently sought for the rapid identification of new drugs that have a novel MoA at the time of discovery.

Parasite cell morphology within the human contains inherent MoA-predictive capacity. Intracellular parasite morphology can distinguish broad stages along the developmental continuum of the asexual parasite (responsible for all disease pathology). This developmental continuum includes early development (early and late ring form), feeding (trophozoite), genome replication or cell division (schizont), and extracellular emergence [merozoite; see (6) for definitions]. Hence, drugs targeting a particular stage should manifest a break in the continuum. Morphological variation in the parasite cell away from the continuum of typical development may also aid drug MoA prediction if higher information granularity can be generated during a cell-based screen. Innovations in automated fluorescence microscopy have markedly expanded available data content in cell imaging (7). By using multiple intracellular markers, an information-rich landscape can be generated from which morphology, and, potentially, drug MoA can be deduced. This increased data content is, however, currently inaccessible both computationally and because it requires manual expert-level analysis of cell morphology. Thus, efforts to use cell-based screens to find drugs and define their MoA in a time-efficient manner are still limited.

Machine learning (ML) methods offer a powerful alternative to manual image analysis, particularly deep neural networks (DNNs) that can learn to represent data succinctly. To date, supervised ML has been the most successful application for classifying imaging data, commonly based on binning inputs into discrete, human-defined outputs. Supervised methods using this approach have been applied to study mammalian cell morphologies (8, 9) and host-pathogen interactions (10). However, discrete outputs are poorly suited for capturing a continuum of morphological phenotypes, such as those that characterize either malaria parasite development or compound-induced outliers, since it is difficult or impossible to generate labels of all relevant morphologies a priori. A cell imaging approach is therefore needed that can function with minimal discrete human-derived training data before computationally defining a continuous analytical space, which mirrors the heterogeneous nature of biological space.

Here, we have created a semi-supervised model that discriminates diverse morphologies across the asexual life cycle continuum of the malaria parasite P. falciparum. By receiving input from a deep metric network (11) trained to represent similar consumer images as nearby points in a continuous coordinate space (an embedding), our DNN can successfully define unperturbed parasite development with a much finer information granularity than human labeling alone. The same DNN can quantify antimalarial drug effects both in terms of life cycle distribution changes [e.g., killing specific parasite stage(s) along the continuum] and morphological phenotypes or outliers not seen during normal asexual development. Combining life cycle and morphology embeddings enabled the DNN to group compounds by their MoA without directly training the model on these morphological outliers. This DNN analysis approach toward cell morphology therefore addresses the combined needs of high-throughput cell-based drug discovery that can rapidly find new hits and predict MoA at the time of identification.

Using ML, we set out to develop a high-throughput, cell-based drug screen that can define cell morphology and drug MoA from primary imaging data. From the outset, we sought to embrace asynchronous (mixed stage) asexual cultures of the human malaria parasite, P. falciparum, devising a semi-supervised DNN strategy that can analyze fluorescence microscopy images. The workflow is summarized in Fig. 1 (A to C).

(A) To ensure all life cycle stages were present during imaging and analysis, two transgenic malaria cultures, continuously expressing sfGFP, were combined (see Materials and Methods); these samples were incubated with or without drugs before being fixed and stained for automated multichannel high-resolution, high-throughput imaging. Resulting datasets (B) contained parasite nuclei (blue), cytoplasm (not shown), and mitochondrion (green) information, as well as the RBC plasma membrane (red) and brightfield (not shown). Here, canonical examples of a merozoite, ring, trophozoite, and schizont stage are shown. These images were processed for ML analysis (C) with parasites segregated from full field of views using the nuclear stain channel, before transformation into embedding vectors. Two networks were used; the first (green) was trained on canonical examples from human-labeled imaging data, providing MLderived labels (pseudolabels) to the second semi-supervised network (gray), which predicted life cycle stage and compound phenotype. Example images from human-labeled datasets (D) show that disagreement can occur between human labelers when categorizing parasite stages (s, schizont; t, trophozoite; r, ring; m, merozoite). Each thumbnail image shows (from top left, clockwise) merged channels, nucleus staining, cytoplasm, and mitochondria. Scale bar, 5 m.

The P. falciparum life cycle commences when free micron-sized parasites (called merozoites; Fig. 1B, far left) target and invade human RBCs. During the first 8 to 12 hours after invasion, the parasite is referred to as a ring, describing its diamond ringlike morphology (Fig. 1B, left). The parasite then feeds extensively (trophozoite stage; Fig. 1B, right), undergoing rounds of DNA replication and eventually divides into ~20 daughter cells (the schizont-stage; Fig. 1B, far right), which precedes merozoite release back into circulation (6). This discrete categorization belies a continuum of morphologies between the different stages.

The morphological continuum of asexual development represents a challenge when teaching ML models, as definitions of each stage will vary between experts (Fig. 1D and fig. S1). To embrace this, multiple human labels were collected. High-resolution three-dimensional (3D) images of a 3D7 parasite line continuously expressing superfolder green fluorescent protein (sfGFP) in the cytoplasm (3D7/sfGFP) were acquired using a widefield fluorescence microscope (see Materials and Methods), capturing brightfield DNA [4,6-diamidino-2-phenylindole (DAPI), cytoplasm (constitutively expressed sfGFP), mitochondria (MitoTracker abbreviated subsequently to MITO)], and the RBC membrane [fluorophore-conjugated wheat germ agglutinin (WGA)]. 3D datasets were converted to 2D images using maximum intensity projection. Brightfield was converted to 2D using both maximum and minimum projection, resulting in six channels of data for the ML. Labels (5382) were collected from human experts, populating the categories of ring, trophozoite, schizont, merozoite, cluster-of-merozoites (multiple extracellular merozoites attached after RBC rupture), or debris. For initial validation and as a test of reproducibility between experts, an additional 448 parasites were collected, each labeled by five experts (Fig. 1D).

As demonstrated (Fig. 1D and fig. S1A), human labelers show some disagreement, particularly between ring and trophozoite stages. This disagreement is to be expected, with mature ring stage and early trophozoite stage images challenging to define even for experts. When comparing the human majority vote versus the model classification (fig. S1B and note S1), some disagreement was seen, particularly for human-labeled trophozoites being categorized as ring stages by the ML algorithm.

Image patches containing parasites within the RBC or after merozoite release were transformed into input embeddings using the deep metric network architecture originally trained on consumer images (11) and previously shown for microscopy images (12). Embeddings are vectors of floating point numbers representing a position in high-dimensional space, trained so related objects are located closer together. For our purposes, each image channel was individually transformed into an embedding of 64 dimensions before being concatenated to yield one embedding of 384 dimensions per parasite image.

Embeddings generated from parasite images were next transformed using a two-stage workflow to represent either on-cycle (for mapping the parasite life cycle continuum) or off-cycle effects (for mapping morphology or drug induced outliers). Initially, an ensemble of fully connected two-layer DNN models was trained on the input embeddings to predict the categorical human life cycle labels for dimethyl sulfoxide (DMSO) controls. DMSO controls consisted of the vehicle liquid for drug treatments (DMSO) being added to wells containing no drugs. For consistency, the volume of DMSO was normalized in all wells to 0.5%. This training gave the DNN robustness to control for sample heterogeneity and, hence, sensitivity for identifying unexpected results (outliers). The ensemble was built from three pairs of fully supervised training conditions (six total models). Models only differed in the training data they received. Each network pair was trained on separate (nonoverlapping) parts of the training data, providing an unbiased estimate of the model prediction variance.

After initial training, the supervised DNN predicted its own labels (i.e., pseudolabels) for previously unlabeled examples. As with human-derived labels, DNN pseudolabeling was restricted to DMSO controls (with high confidence) to preserve the models sensitivity to off-cycle outliers (which would not properly fit into on-cycle outputs). High confidence was defined as images given the same label prediction from all six models and when all models were confident of their own prediction (defined as twice the probability of selecting the correct label at random). This baseline random probability is a fixed number for a dataset or classification and provided a suitable baseline for model performance.

A new ensemble of models was then trained using the combination of human-derived labels and DNN pseudolabels. The predictions from this new ensemble were averaged to create the semi-supervised model.

The semi-supervised model was first used to represent the normal (on-cycle) life cycle continuum. We selected the subset of dimensions in the unnormalized final prediction layer that corresponded to merozoites, rings, trophozoites, and schizonts. This was projected into 2D space using principal components analysis (PCA) and shifted such that its centroid was at the origin. This resulted in a continuous variable where angles represent life cycle stage progression, referred to as Angle-PCA. This Angle-PCA approach permitted the full life cycle to be observed as a continuum with example images despite data heterogeneity (Fig. 2A and fig. S2) and 2D projection (Fig. 2B) following the expected developmental order of parasite stages. This ordered continuum manifested itself without specific constraints being imposed, except those provided by the categorical labels from human experts (see note S2).

After learning from canonical human-labeled parasite images (for examples, please see Fig. 1B) and filtering debris and other outliers, the remaining life cycle data from asynchronous cultures was successfully ordered by the model. The parasites shown are randomly selected DMSO control parasites from multiple imaging runs, sorted by Angle PCA (A). The colored, merged images show RBC membrane (red), mitochondria (green), and nucleus (blue). For a subset of parasites on the right, the colored, merged image plus individual channels are shown: (i) merged, (ii) brightfield minimum projection, (iii) nucleus, (iv) cytoplasm, (v) mitochondria, and (vi) RBC membrane (brightfield maximum projection was also used in ML but is not shown here). The model sorts the parasites in life cycle stage order, despite heterogeneity of signal due to nuances such as imaging differences between batches. The order of the parasites within the continuum seen in (A) is calculated from the angle within the circle created by projecting model outputs using PCA, creating a 2D scatterplot (B). This represents a progression through the life cycle stages of the parasite, from individual merozoites (purple) to rings (yellow), trophozoites (green), schizonts (dark green), and finishing with a cluster of merozoites (blue). The precision-recall curve (C) shows that human labelers and the model have equivalent accuracy in determining the earlier/later parasite in pairs. The consensus of the human labelers was taken as ground truth, with individual labelers (orange) agreeing with the consensus on 89.5 to 95.8% of their answers. Sweeping through the range of too close to call values with the ML model yields the ML curve shown in black. Setting this threshold to 0.11 radians, the median angle variance across the individual models used in the ensemble yields the blue dot.

To validate the accuracy of the continuous life cycle prediction, pairs of images were shown to human labelers to define their developmental order (earlier/later) with the earliest definition being the merozoite stage. Image pairs assessed also included those considered indistinguishable (i.e., too close to call). Of the 295 pairs selected for labeling, 276 measured every possible pairing between 24 parasites, while the remaining 19 pairs were specifically selected to cross the trophozoite/schizont boundary. Human expert agreement with the majority consensus was between 89.5 and 95.8% (note S3), with parasite pairs called equal (too close to call) to 25.7 to 44.4% of the time. These paired human labels had more consensus than the categorical (merozoite, ring, trophozoite, and schizont) labels that had between 60.9 and 78.4% agreement between individual human labels and the majority consensus.

The Angle-PCA projection results provide an ordering along the life cycle continuum, allowing us to compare this sort order to that by human experts. With our ensemble of six models, we could also evaluate the consensus and variation between angle predictions for each example. The consensus between models for relative angle between two examples was greater than 96.6% (and an area under the precision-recall curve score of 0.989; see note S4 for definition), and the median angle variation across all labeled examples was 0.11 radians. The sensitivity of this measurement can be tuned by selecting a threshold for when two parasites are considered equal, resulting in a precision-recall curve (Fig. 2C). When we use the median angle variation of the model as the threshold for examples that are too close to call, we get performance (light blue point) that is representative of the human expert average. These results demonstrate that our semi-supervised model successfully identified and segregated asynchronous parasites and infected RBCs from images that contain >90% uninfected RBCs (i.e., <10% parasitaemia) and classifies parasite development logically along the P. falciparum asexual life cycle.

Having demonstrated the semi-supervised model can classify asynchronous life cycle progression consistently with fine granularity, the model was next applied to quantify on-cycle differences (i.e., life cycle stage-specific drug effects) in asynchronous, asexual cultures treated with known antimalarial drugs. Two drug treatments were initially chosen that give rise to aberrant cellular development: the ATP4ase inhibitor KAE609 (also called Cipargamin) (13) and the mitochondrial inhibiting combinational therapy of atovaquone and proguanil (14) (here referred to as Ato/Pro). KAE609 reportedly induces cell swelling (15), while Ato/Pro reduces mitochondrial membrane potential (16). Drug treatments were first tested at standard screening concentrations (2 M) for two incubation periods (6 and 24 hours). Next, drug dilutions were carried out to test the semi-supervised models sensitivity to lower concentrations using half-median inhibitory concentrations (IC50s) of each compound (table S1). IC50 and 2 M datasets were processed through the semi-supervised model and overlaid onto DMSO control data as a histogram to explore on-cycle drug effects (Fig. 3). KAE609 treatment exhibited a consistent skew toward ring stage parasite development (8 to 12 hours after RBC invasion; Fig. 3) without an increase within this stage of development, while the Ato/Pro treatment led to reduced trophozoite stages (~12 to 30 hours after RBC invasion; Fig. 3). This demonstrates that the fine-grained continuum has the sensitivity to detect whether drugs affect specific stages of the parasite life cycle.

Asynchronous Plasmodium falciparum cultures were treated with the ATPase4 inhibitor KAE609 or the combinational MITO treatment of atovaquone and proguanil (Ato/Pro) with samples fixed and imaged 6 (A) and 24 (B) hours after drug additions. Top panels show histograms indicating the number of parasites across life cycle continuum. Compared to DMSO controls (topmost black histogram), both treatments demonstrated reduced parasite numbers after 24 hours. Shown are four drug/concentration treatment conditions: low-dose Ato/Pro (yellow), high-dose Ato/Pro (orange), low-dose KAE609 (light blue), and high-dose KAE609 (dark blue). Box plots below demonstrate life cycle classifications in the DMSO condition of images from merozoites (purple) to rings (yellow), trophozoites (green), and finishing with schizonts (dark green).

The improved information granularity was extended to test whether the model could identify drug-based morphological phenotypes (off-cycle) toward determination of MoA. Selecting the penultimate 32-dimensional layer of the semi-supervised model meant that, unlike the Angle-PCA model, outputs were not restricted to discrete on-cycle labels but instead represented both on- and off-cycle changes. This 32-dimensional representation is referred to as the morphology embedding.

Parasites were treated with 1 of 11 different compounds, targeting either PfATP4ase (ATP4) or mitochondria (MITO) and DMSO controls (table S1). The semi-supervised model was used to evaluate three conditions: random, where compound labels were shuffled; Angle-PCA, where the two PCA coordinates are used; and full embedding, where the 32-dimensional embedding was combined with the Angle-PCA. To add statistical support that enables compound level evaluation, a bootstrapping of the analysis was performed, sampling a subpopulation of parasites 100 times.

As expected, the randomized labels led to low accuracy (Fig. 4A), serving as a baseline for the log odds (probability). When using the 2D Angle-PCA (on-cycle) information, there was a significant increase over random in the log odds ratio (Fig. 4A). This represents the upper-bound information limit for binary live/dead assays due to their insensitivity to parasite stages. When using the combined full embedding, there was a significant log odds ratio increase over both the random and Angle-PCA conditions (Fig. 4A). To validate that this improvement was not a consequence of having a larger dimensional space compared to the Angle-PCA, an equivalent embedding from the fully supervised model trained only on expert labels (and not on pseudolabels) demonstrated approximately the same accuracy and log odds ratio as Angle-PCA. Thus, our semi-supervised model can create an embedding sensitive to the phenotypic changes under distinct MoA compound treatment.

To better define drug effect on Plasmodium falciparum cultures, five mitochondrial (orange text) and five PfATP4ase (blue text) compounds were used; after a 24-hour incubation, images were collected and analyzed by the semi-supervised model. To test performance, various conditions were used (A). For random, images and drug names were scrambled, leading to the model incorrectly grouping compounds based on known MoA (B). Using life cycle stage definition (as with Fig. 3), the model generated improved grouping of compounds (C) versus random. Last, by combining the life cycle stage information with the penultimate layer (morphological information, before life cycle stage definition) of the model, it led to correct segregation of drugs based on their known MoA (D).

To better understand drug MoA, we evaluated how the various compounds were grouped together by the three approaches (random, Angle-PCA, and morphology embedding), performing a hierarchical linkage dendrogram (Fig. 4, B to D). The random approach shows that, as expected, the different compounds do not reveal MoA similarities. For the Angle-PCA output, the MITO inhibitors atovaquone and antimycin are grouped similarly, but the rest of the clusters are a mixture of compounds from the two MoA groups. Last, the morphology embedding gave rise to an accurate separation between the two groups of compounds having different MoA. One exception for grouping was atovaquone (when used alone), which was found to poorly cluster with either group (branching at the base of the dendrogram; Fig. 4D). This result is likely explained by the drug dosages used, as atovaquone is known to have a much enhanced potency when used in combination with proguanil (16).

The semi-supervised model was able to consistently cluster MITO inhibitors away from ATP4ase compounds in a dimensionality that suggested a common MoA. Our semi-supervised model can therefore successfully define drug efficacy in vitro and simultaneously assign a potential drug MoA from asynchronous (and heterogeneous) P. falciparum parasite cultures using an imaging-based screening assay with high-throughput capacity.

Driven by the need to accelerate novel antimalarial drug discovery with defined MoA from phenotypic screens, we applied ML to images of asynchronous P. falciparum cultures. This semi-supervised ensemble model could identify effective drugs and cluster them according to MoA, based on life cycle stage (on-cycle) and morphological outliers (off-cycle).

Recent image-based ML approaches have been applied to malaria cultures but have, however, focused on automated diagnosis of gross parasite morphologies from either Giemsa- or Leishman-stained samples (1719), rather than phenotypic screening for drug MoA. ML of fluorescence microscopy images have reported malaria identification of patient-derived blood smears (20) and the use of nuclear and mitochondrial specific dyes for stage categorization and viability (21), although the algorithmic approach did not include deep learning. Previous unsupervised and semi-supervised ML approaches have been applied to identify phenotypic similarities in other biological systems, such as cancer cells (12, 2224), but none have addressed the challenge of capturing the continuum of biology within the heterogeneity of control conditions. We therefore believe our study represents a key milestone in the use of high-resolution imaging data beyond diagnostics to predict the life cycle continuum of a cell type (coping with biological heterogeneity), as well as using this information to indicate drug-induced outliers and successfully group these toward drug MoA.

Through semi-supervised learning, only a small number of human-derived discrete but noisy labels from asynchronous control cultures were required for our DNN method to learn and distribute data as a continuous variable, with images following the correct developmental order. By reducing expert human input, which can lead to image identification bias (see note S2), this approach can control for interexpert disagreement and is more time efficient. This semi-supervised DNN therefore extends the classification parameters beyond human-based outputs, leading to finer information granularity learned from the data automatically through pseudolabels. This improved information, derived from high-resolution microscopy data, permits the inclusion of subtle but important features to distinguish parasite stages and phenotypes that would otherwise be unavailable.

Our single model approach was trained on life cycle stages through embedding vectors, whose distribution allows identification of two readouts, on-cycle (sensitive to treatments that slow the life cycle or kill a specific parasite stage) and off-cycle (sensitive to treatments that cluster away from control distributions). We show that this approach with embeddings was sensitive to stage-specific effects at IC50 drug concentrations (Fig. 3), much lower than standard screening assays. Drug-based outliers were grouped in a MoA-dependent manner (Fig. 4), with data from similar compounds grouped closer than data with unrelated mechanisms.

The simplicity of fluorescence imaging means that this method could be applied to different subcellular parasite features, potentially improving discrimination of cultures treated with other compounds. In addition, imaging the sexual (gametocyte) parasite stages with and without compound treatments will build on the increasing need for drugs, which target multiple stages of the parasite life cycle (25). Current efforts to find drugs targeting the sexual stages of development are hampered by the challenges of defining MoA from a nonreplicating parasite life cycle stage (25). This demonstrates the potential power of a MoA approach, applied from the outset of their discovery, simply based on cell morphology.

In the future, we envisage that on-cycle effects could elucidate the power of combinational treatments (distinguishing treatments targeting different life cycle stages) for a more complete therapy. Using off-cycle, this approach could identify previously unidentified combinational treatments based on MoA. Because of the sample preparation simplicity, this approach is also compatible with using drug-resistant parasite lines.

New drugs against malaria are seen as a key component of innovation required to bend the curve toward the diseases eradication or risk a return to premillennium rates (3, 26). Seen in this light, application of ML-driven screens should enable the rapid, large-scale screening and identification of drugs with concurrent determination of predicted MoA. Since ML-identified drugs will start from the advanced stage of predicted MoA, these should bolster the much-needed development of new chemotherapeutics for the fight against malaria.

To generate parasite line 3D7/sfGFP, 3D7 ring stages were transfected with both plasmids pkiwi003 (p230p-bsfGFP) and pDC2-cam-co.Cas9-U6.2-hDHFR _P230p (50 g each; fig. S3) following standard procedures (27) and selected on 4 nM WR99210 (WR) for 10 days. pDC2-cam-co.Cas9-U6.2-hDHFR _P230p encodes for Cas9 and the guide RNA for the P230p locus. pkiwi003 comprises the repair sequence to integrate into the P230p locus after successful double-strand break induced by the Cas9. pkiwi003 (p230p-bsfGFP) was obtained by inserting two polymerase chain reaction (PCR) fragments both encoding parts of P230p (PF3D7_0208900) consecutively into the pBluescript SK() vector with Xho I/Hind III and Not I/Sac I, respectively. sfGFP together with the hsp70 (bip) 5 untranslated region was PCR-amplified from pkiwi002 and cloned into pkiwi003 with Hind III/Not I. pkiwi002 is based on pBSp230pDiCre (28), where the FRB (binding domain of the FKBP12rapamycin-associated protein) and Cre60 cassette (including promoter and terminator) was removed with Afe I/Spe I, and the following linkers inserted are as follows: L1_F cctttttgcccccagcgctatataactagtACAAAAAAGTATCAAG and L1_R CTTGATACTTTTTTGTactagttatatagcgctgggggcaaaaagg. In a second step, FKBP (the immunophilin FK506-binding protein) and Cre59 were removed with Nhe I/Pst I and replaced by sfGFP, which was PCR-amplified from pCK301 (29). pDC2-cam-co.Cas9-U6.2-hDHFR _P230p was obtained by inserting the guide RNA (AGGCTGATGAAGACATCGGG) into pDC2-cam-co.Cas9-U6.2-hDHFR (30) with Bbs I. Integration of pkiwi003 into the P230p locus was confirmed by PCR using primers #99 (ACCATCAACATTATCGTCAG), #98 (TCTTCATCAGCCTGGTAAC), and #56 (CATTTACACATAAATGTCACAC; fig. S3).

The transgenic 3D7/sfGFP P. falciparum asexual parasites were cultured at 37C (with a gas mixture of 90% N2, 5% O2, and 5% CO2) in human O+ erythrocytes under standard conditions (31), with RMPI-Hepes medium supplemented with 0.5% AlbuMAX-II. Two independent stocks (culture 1 and culture 2; Fig. 1A) of 3D7/sfGFP parasites were maintained in culture and synchronized separately with 5% d-sorbitol on consecutive days to ensure acquisition of all stages of the asexual cycle on the day of sample preparation. Samples used for imaging derived from cultures harboring an approximate 1:1:1 ratio of rings, trophozoites, and schizonts, with a parasitaemia around 10%.

Asexual cultures were diluted 50:50 in fresh media before 50 nM MitoTracker CMXRos (Thermo Fisher Scientific) was added for 20 min at 37C. Samples were then fixed in phosphate-buffered saline (PBS) containing 4% formaldehyde and 0.25% glutaraldehyde and placed on a roller at room temperature, protected from light for 20 min. The sample was then washed 3 in PBS before 10 nM DAPI, and WGA (5 g/ml) conjugated to Alexa Fluor 633 was added for 10 min and protected from light. The sample was then washed 1 in PBS and diluted 1:30 in PBS before pipetting 100 l into each well of a CellVis (Mountain View, CA) 96-well plate.

Samples were imaged using a Nikon Ti-Eclipse widefield microscope and Hamamatsu electron multiplying charge-coupled device camera, with a 100 Plan Apo 1.4 numerical aperture (NA) oil objective lens (Nikon); the NIS-Elements JOBS software package (Nikon) was used to automate the plate-based imaging. The five channels [brightfield, DNA (DAPI), cytoplasm (sfGFP-labeled), mitochondria (MitoTracker or MITO), and RBC (WGA-633)] were collected serially at Nyquist sampling as a 6-m z-stack, with fluorescent excitation from the CoolLED light source. To collect enough parasite numbers per treatment, 32 fields of view (sites) were randomly generated and collected within each well, with treatments run in technical triplicate. Data were saved directly onto an external hard drive for short-term storage and processing (see below).

The 3D images were processed via a custom macro using ImageJ and transformed into 2D maximum intensity projection images. Brightfield channels were also projected using the minimum intensity projection as this was found to improve analysis of the food vacuole and anomalies including double infections. Converting each whole-site image to per-parasite embedding vectors was performed as previously described (12), with some modifications: The Otsu threshold was set to the minimum of the calculated threshold or 1.25 of the foreground mean of the image, and centers closer than 100 pixels were pruned. Each channel image was separately fed as a grayscale image into the deep metric network for conversion into a 64-dimension embedding vector. The six embedding vectors (one from each fluorescent channel and both minimum and maximum projections of the brightfield channel) were concatenated to yield a final 384 dimension embedding vector.

All labels were collected using the annotation tool originally built for collecting diabetic retinopathy labels (32). For each set of labels gathered, tiled images were stitched together to create a collage for all parasites to be labeled. These collages contained both stains in grayscale and color overlays to aid identification. Collages and a set of associated questions were uploaded to the annotation tool, and human experts (Imperial College London) provided labels (answers). In cases where multiple experts labeled the same image, a majority vote was used to determine the final label.

Initial labels for training classified parasites into 1 of 11 classes: merozoite, ring, trophozoite, schizont, cluster of merozoites, multiple infection, bad image, bad patch (region of interest) location, parasite debris, unknown parasite inside an RBC, or other. Subsequent labels were collected with parasite debris classified further into the following: small debris remnant, cluster of debris, and death inside a RBC (table S2). For training, the following labels were dropped: bad image, bad patch location, unknown parasite inside an RBC, unspecified parasite debris, and other. For these labels, five parasites were randomly sampled from each well of experiments.

To validate the model performance, an additional 448 parasites were labeled by five experts. The parasites were selected from eight separate experimental plates using only control image data (DMSO only).

Last, paired labels were collected to validate the sort-order results. For these labels, the collage included two parasites, and experts identified which parasite was earlier in the life cycle or whether the parasites were too close to call. Here, data from the 448 parasite validation set were used, limited to cases where all experts agreed that the images were of a parasite inside an RBC. From this set, 24 parasites were selected, and all possible pairings of these 24 parasites were uploaded as questions (24 choose 2 = 276 questions uploaded). In addition, another 19 pairs were selected that were near the trophozoite/schizont boundary to enable angle resolution analysis.

To prepare the data for analysis, the patch embeddings were first joined with the ground truth labels for patches with labels. Six separate models were trained on embeddings to classify asexual life cycle stages and normal anomalies such as multiple infection, cell death, and cellular debris. Each model was a two-layered (64 and 32 dimensions), fully connected (with ReLu nonlinearities) neural network. To create training data for each of the six models, human-labeled examples were partitioned so that each example within a class is randomly assigned to one of four partitions. Each partition is a split of the data with example images randomly placed into a partition (subject to the constraint that it is balanced for each life cycle category). Each model was then trained on one of the six ways to select a pair from the four partitions. Training was carried out with a batch size of 128 for 1000 steps using the Adam optimizer (33) with a learning rate of 2 104. Following the initial training, labels were predicted on all unlabeled data using all six models, and for each class, 400 examples were selected with the highest mean probability (and at least a mean probability of 0.4) and with an SD of the probability less than 0.07 (which encompasses the majority of the predictions with labels). The training procedure was repeated with the original human labels and predicted (pseudo-) labels to generate our final model. The logits are extracted from the trained model, and a subspace representing the normal life cycle stages is projected using 2D by PCA. The life cycle angle is computed as arctan(y/x), where x and are the first and second coordinates of the projection, respectively.

For each drug with a certain dose and application duration, the evaluation of its effect is based on the histogram of the classified asexual life cycle stages, and finer binned stages obtained from the estimated life cycle angle. A breakdown of labeled images for drug morphologies is given in table S3.

WHO, World Malaria Report (Geneva, 2019).

J. Wang, Y. Song, T. Leung, C. Rosenberg, J. Wang, J. Philbin, B. Chen, Y. Wu, Learning Fine-Grained Image Similarity with Deep Ranking, paper presented at the Proceedings of the 2014 IEEE Conference on Computer Vision and Pattern Recognition (IEEE, 2014), pp. 13861393.

View original post here:
A machine learning approach to define antimalarial drug action from heterogeneous cell-based screens - Science Advances

Comprehensive Report on Artificial Intelligence and Machine Learning Market 2020 | Size, Growth, Demand, Opportunities & Forecast To 2026 |…

Artificial Intelligence and Machine Learning Market research report is the new statistical data source added by A2Z Market Research.

Artificial Intelligence and Machine Learning Market is growing at a High CAGR during the forecast period 2020-2026. The increasing interest of the individuals in this industry is that the major reason for the expansion of this market.

Artificial Intelligence and Machine Learning Market research is an intelligence report with meticulous efforts undertaken to study the right and valuable information. The data which has been looked upon is done considering both, the existing top players and the upcoming competitors. Business strategies of the key players and the new entering market industries are studied in detail. Well explained SWOT analysis, revenue share and contact information are shared in this report analysis.

Get Sample Copy (Including FULL TOC, Graphs and Tables) of this report @:

https://www.a2zmarketresearch.com/sample?reportId=321664

Note In order to provide more accurate market forecast, all our reports will be updated before delivery by considering the impact of COVID-19.

Top Key Players Profiled in this report are:

GoogleInc., Microsoft Corporation, Amazon Web Services Inc., SAS Institute Inc., SAP SE, BaiduInc., IBM Corporation, Hewlett Packard Enterprise Development LP (HPE), BigMLInc., Fair Isaac Corporation, Intel Corporation

The key questions answered in this report:

Various factors are responsible for the markets growth trajectory, which are studied at length in the report. In addition, the report lists down the restraints that are posing threat to the global Artificial Intelligence and Machine Learning market. It also gauges the bargaining power of suppliers and buyers, threat from new entrants and product substitute, and the degree of competition prevailing in the market. The influence of the latest government guidelines is also analyzed in detail in the report. It studies the Artificial Intelligence and Machine Learning markets trajectory between forecast periods.

Get up to 30% Discount on this Premium Report @:

https://www.a2zmarketresearch.com/discount?reportId=321664

The cost analysis of the Global Artificial Intelligence and Machine Learning Market has been performed while keeping in view manufacturing expenses, labor cost, and raw materials and their market concentration rate, suppliers, and price trend. Other factors such as Supply chain, downstream buyers, and sourcing strategy have been assessed to provide a complete and in-depth view of the market. Buyers of the report will also be exposed to a study on market positioning with factors such as target client, brand strategy, and price strategy taken into consideration.

Global Artificial Intelligence and Machine Learning Market Segmentation:

Market Segmentation by Type:

Deep LearningNatural Language ProcessingMachine VisionOthers

Market Segmentation by Application:

BFSIHealthcare and Life SciencesRetailTelecommunicationGovernment and DefenseManufacturingEnergy and UtilitiesOthers

The report provides insights on the following pointers:

Table of Contents

Global Artificial Intelligence and Machine Learning Market Research Report 2020 2026

Chapter 1 Artificial Intelligence and Machine Learning Market Overview

Chapter 2 Global Economic Impact on Industry

Chapter 3 Global Market Competition by Manufacturers

Chapter 4 Global Production, Revenue (Value) by Region

Chapter 5 Global Supply (Production), Consumption, Export, Import by Regions

Chapter 6 Global Production, Revenue (Value), Price Trend by Type

Chapter 7 Global Market Analysis by Application

Chapter 8 Manufacturing Cost Analysis

Chapter 9 Industrial Chain, Sourcing Strategy and Downstream Buyers

Chapter 10 Marketing Strategy Analysis, Distributors/Traders

Chapter 11 Market Effect Factors Analysis

Chapter 12 Global Artificial Intelligence and Machine Learning Market Forecast

Buy Exclusive Report @:

https://www.a2zmarketresearch.com/buy?reportId=321664

If you have any special requirements, please let us know and we will offer you the report as you want.

About A2Z Market Research:

The A2Z Market Research library provides syndication reports from market researchers around the world. Ready-to-buy syndication Market research studies will help you find the most relevant business intelligence.

Our Research Analyst Provides business insights and market research reports for large and small businesses.

The company helps clients build business policies and grow in that market area. A2Z Market Research is not only interested in industry reports dealing with telecommunications, healthcare, pharmaceuticals, financial services, energy, technology, real estate, logistics, F & B, media, etc. but also your company data, country profiles, trends, information and analysis on the sector of your interest.

Contact Us:

Roger Smith

1887 WHITNEY MESA DR HENDERSON, NV 89014

[emailprotected]

+1 775 237 4147

See original here:
Comprehensive Report on Artificial Intelligence and Machine Learning Market 2020 | Size, Growth, Demand, Opportunities & Forecast To 2026 |...

Machine Learning Market 2020 Will Emerge Globally And Grow upto 44.3% of CAGR by 2026 – The Daily Chronicle

The Global Machine Learning Market size is projected to reach USD 33.4 Bn by 2026 from USD 1.7 Bn in 2018, at a CAGR of 44.3% during the forecast period.

The Machine LearningMarket Research Report helps out market players to improve their business plans and ensure long-term success. The extensive research study provides in-depth information on Global Innovations, New Business Techniques, SWOT Analysis with Key Players, Capital Investment, Technology Innovation, and Future Trends Outlook.

Browes complete Report and Toc,https://www.alltheresearch.com/report/285/Machine-Learning

The market research study covers historical data of previous years along with a forecast of upcoming years based on revenue (USD million). The Machine Learning Market reports also cover market dynamics, market overview, segmentation, market drivers, and restraints together with the impact they have on the Machine Learningdemand over the forecast period. Moreover, the report also delivers the study of opportunities available in the Machine Learningmarket globally. The Machine Learningmarket report study and forecasts is based on a worldwide and regional level.

If you are investor/shareholder in the Machine LearningMarket, the provided study will help you to understand the growth model of Machine LearningIndustry after impact of COVID-19. Request for sample report (including ToC, Tables and Figures with detailed information) @https://www.alltheresearch.com/impactC19-request/285

The report assesses the key opportunities in the market and outlines the factors that are and will be driving the growth of the Machine Learningindustry. Growth of the overall Machine Learningmarket has also been forecasted for the period 2019-2025, taking into consideration the previous growth patterns, the growth drivers and the current and future trends.

Market Segments and Sub-segments Covered in the Report are as per below:

Based on Product Type Machine Learningmarket is segmented into:

Based on Application Machine Learningmarket is segmented into:

The major players profiled in this report include:

Get Exclusive Sample Report on Machine Learning Market is available at https://www.alltheresearch.com/sample-request/285

Regional Coverage of the Machine LearningMarket:

Key Questions Answered in this Report:

What is the market size of the Machine Learningindustry?This report covers the historical market size of the industry (2013-2019), and forecasts for 2020 and the next 5 years. Market size includes the total revenues of companies.

What is the outlook for the Machine Learningindustry?This report has over a dozen market forecasts (2020 and the next 5 years) on the industry, including total sales, a number of companies, attractive investment opportunities, operating expenses, and others.

What industry analysis/data exists for the Machine Learningindustry?This report covers key segments and sub-segments, key drivers, restraints, opportunities, and challenges in the market and how they are expected to impact the Machine Learningindustry. Take a look at the table of contents below to see the scope of analysis and data on the industry.

How many companies are in the Machine Learningindustry?This report analyzes the historical and forecasted number of companies, locations in the industry, and breaks them down by company size over time. The report also provides company rank against its competitors with respect to revenue, profit comparison, operational efficiency, cost competitiveness, and market capitalization.

What are the financial metrics for the industry?This report covers many financial metrics for the industry including profitability, Market value- chain, and key trends impacting every node with reference to the companys growth, revenue, return on sales, etc.

What are the most important benchmarks for the Machine Learningindustry?Some of the most important benchmarks for the industry include sales growth, productivity (revenue), operating expense breakdown, span of control, organizational make-up. All of which youll find in this market report.

Get Chance of 20% Extra Discount, If your Company is Listed in Above Key Players Listhttps://www.alltheresearch.com/speak-to-analyst/285

FOR ALL YOUR RESEARCH NEEDS, REACH OUT TO US AT:Contact Name: Rohit B.Email:[emailprotected]Phone: 1-888-691-6870

View original post here:
Machine Learning Market 2020 Will Emerge Globally And Grow upto 44.3% of CAGR by 2026 - The Daily Chronicle

From the Sky Above to the Sea Below – UCI News

The UCI researchers who probe the Earth and sky for answers to momentous questions about the environment, the oceans and the atmosphere have gotten smart about unlocking solutions. The key: They turn billions of pieces of data into insights by embracing artificial intelligence and machine learning.

AI with its growing presence on campuses worldwide has already transformed what computers can do for scientists and is now being touted as potentially revolutionizing academic research in the next few years.

The excitement is palpable, says James Bullock, dean of the School of Physical Sciences and professor of physics & astronomy, describing the effect machine learning has had on basic physical science research. There is a sense that were about to experience a phase change in the way science is done.

Roughly half of the schools faculty are using or developing machine learning algorithms to drive new discoveries, he says, in areas that include climate change, particle physics, quantum simulation and materials science.

Probably the most oversubscribed talk series in the School of Physical Sciences is our Machine Learning Nexus seminar, which brings together researchers from all of our subfields astronomy, chemistry, climate science and physics to share techniques and ideas in this domain, Bullock notes.

In addition to its uses in academic research, machine learning equips students with the expertise to pursue a variety of careers in well-established companies or in industrial research.

Shane Coffield, a Ph.D. candidate in Earth system science who was drawn to UCI because of its AI program, is collaborating with colleagues on predictive models for the intensity and spread of California wildfires. Photo by Steve Zylius/UCI.

Shane Coffield, a Ph.D. candidate in Earth system science, says that the universitys machine learning program influenced his decision to choose UCI for his graduate education.

It started a really fruitful collaboration, he says. I get to work with experts who help me understand the best tools to apply to my science. Coffield and his UCI research partners received international media coverage for their wildfire predictions. The group is just one of several UCI Earth system science teams that have had studies utilizing machine learning tools published recently.

Another such team includes Associate Professor Michael Pritchard, who calls AI a big game changer in his field. Hes a cloud guy, with office walls that sport posters of swirling white satellite images.

I remember being enamored with clouds when I was 5 or 6 years old, he says. My family moved around, and I went on a lot of international flights. I fought with my brothers because I always wanted to be next to the window to look at the clouds.

Pritchard worked with researchers from UCI, the Ludwig Maximilian University of Munich and Columbia University to develop deep machine learning tools that would factor clouds into climate models. Their research was published in September 2018 by the Proceedings of the National Academy of Sciences.

Clouds play a major role in the Earths climate by transporting heat and moisture, reflecting and absorbing the suns rays, trapping infrared heat rays, and producing precipitation, says Pritchard, a next-generation climate modeler.

He is particularly fond of stratocumulus clouds the marine layer common in Southern California. Theyre the beautiful clouds you see out your window if you fly from here to Hawaii. Theyre unbroken, ripply, a dazzling bright layer, he says.

But clouds frustrate climate scientists: Its difficult to factor them into predictive models because of their size and variability.

They can be formed by eddies as small as a few hundred meters, much tinier than a standard climate model grid resolution of 50 to 100 kilometers, so simulating them appropriately takes an enormous amount of computer power and time, Pritchard says.

Its hard to know if a warmer world will bring more low-lying clouds that shield Earth from the sun, cooling the planet, or fewer of them, warming it up, he says.

AI, which Earth system scientists find masterfully efficient, could make a difference. If we try to simulate the whole planets atmosphere, were horsepower limited, because we have to simulate it for a hundred years, Pritchard says. But with machine learning, we could speed that up maybe we only have to simulate three months of atmosphere. Then we could really do justice to detailed cloud physics.

While Pritchard looks to the sky for his field of study, his colleague Adam Martiny, professor of Earth system science as well as ecology & evolutionary biology, focuses on the deep blue sea.

AI offers a new way of doing science thats very exciting, says Martiny, noting that it can present the unexpected. His research has contradicted prevalent views about the effects of global warming on phytoplankton in tropical waters. The study was published in January in Nature Geoscience; his co-author was Earth system science professor Francois Primeau.

Martiny, the lead researcher, explains: AI is a set of tools that are super useful when were working with large amounts of data because it helps us see new patterns. In the past, based on our best theories, we had predicted that as the ocean heats, the plankton that lives there would become more stressed.

Instead, using AI, they were able to forecast that phytoplankton populations in low-latitude waters will expand by the end of the 21st century.

We give the model tons and tons of data, Martiny says. Artificial intelligence tools can help us challenge existing paradigms.

Thats exactly what happened in this project. The researchers had a very large dataset describing the abundance of phytoplankton in various regions. We asked what the relationship was between common environmental factors such as nutrients and temperature, Martiny says. Much to our surprise, in the low-latitude regions and tropics, we saw a very significant positive relationship between temperature and abundance of these plankton.

It wasnt what they expected to find. We were very puzzled, he says, because it essentially offered a very different outcome on how warming and stratification would affect these populations.

One possible explanation for the growth focuses on the life cycle of phytoplankton. When plankton die especially these small species they sit around for a while longer, Martiny says. And maybe at higher temperatures, living plankton can more easily degrade them and recycle the nutrients back to build new biomass.

Whats next? The AI and mechanistic models give such opposite results. I dont know which one is right, he says. Thats for the next round of research to figure out. But AI really opened a door.

The same is true for doctoral student Coffield and his collaborators, who have been using AI and machine learning to determine which wildfires will burn out of control. The technique they developed helps project the final size of a fire from the moment of ignition, thus allowing firefighters to more efficiently allocate scarce resources.

The researchers analysis, which focused on Alaskan fires, is highlighted in a study published in September 2019 in the International Journal of Wildland Fire. Coffield worked with an interdisciplinary team and with co-author James Randerson, professor and Ralph J. & Carol M. Cicerone Chair in Earth System Science at UCI.

Alaska was used as the locale for the project because the state has been plagued over the past decade by a rash of concurrent fires in its boreal forests, threatening people and vulnerable ecosystems.

In Alaska, there can be huge numbers of fires burning at the same time, explains lead author Coffield. Our goal was to help fire managers predict the largest fires before they get out of control kind of a triaging system.

Machine learning is promising because were living in a world where theres so much data, he says. You dump in all the data you have, and it figures out the underlying patterns, whereas in the more traditional approach, you know the laws of physics, and you put in the rules and start from the bottom up.

Coffield and the UCI team are now focusing on California fires and forests. Were building off some of the things we learned from the Alaska study, he says, and are creating a more complex machine learning based model for predicting fire spread in California.

Machine learning is a really powerful tool, Coffield adds. Theres so much to be learned from it.

Continued here:
From the Sky Above to the Sea Below - UCI News

Bring On The Qubits: How The Quantum Computing Arms Race Affects Legal – Technology – United States – Mondaq News Alerts

30 September 2020

L2 Counsel

To print this article, all you need is to be registered or login on Mondaq.com.

Both the hardware and algorithms have a long way to go untilthey grace our environments. Quantum computing is not anunattainable innovation, though-it is real enough and, therefore,reachable enough to merit consideration of implications now.

Since its beginnings as a theory developed independently byAmerican physicists Paul Benioff and Richard Feynman and Russianmathematician Yuri Manin, quantum computing has been in a perpetualstate of scientific discovery. It sometimes reaches proof ofprinciple on an approach but has never overcome the engineeringchallenges to move forward. That is, until now. Welcome to KlausSchwab'sfourth industrial revolution, where quantumcomputing is one of the emerging technologies that willfundamentally alter the way we live, work, and relate to oneanother.

Please click here to view the original article.

The content of this article is intended to provide a generalguide to the subject matter. Specialist advice should be soughtabout your specific circumstances.

POPULAR ARTICLES ON: Technology from United States

Morrison & Foerster LLP

In this episode of "Understanding Blockchain," Morrison & Foerster's Susan Gault-Brown and Dario de Martino discuss cryptocurrencies, if they are commodities...

J. Sagar Associates

FinTech Comparative Guide for the jurisdiction of India, check out our comparative guides section to compare across multiple countries

Read the original post:
Bring On The Qubits: How The Quantum Computing Arms Race Affects Legal - Technology - United States - Mondaq News Alerts

ESAs -Week: Digital Twin Earth, Quantum Computing and AI Take Center Stage – SciTechDaily

Digital Twin Earth will help visualize, monitor, and forecast natural and human activity on the planet. The model will be able to monitor the health of the planet, perform simulations of Earths interconnected system with human behavior, and support the field of sustainable development, therefore, reinforcing Europes efforts for a better environment in order to respond to the urgent challenges and targets addressed by the Green Deal. Credit: ESA

ESAs 2020 -week event kicked off this morning with a series of stimulating speeches on Digital Twin Earth, updates on -sat-1, which was successfully launched into orbit earlier this month, and an exciting new initiative involving quantum computing.

The third edition of the -week event, which is entirely virtual, focuses on how Earth observation can contribute to the concept of Digital Twin Earth a dynamic, digital replica of our planet which accurately mimics Earths behavior. Constantly fed with Earth observation data, combined with in situ measurements and artificial intelligence, the Digital Twin Earth provides an accurate representation of the past, present, and future changes of our world.

Digital Twin Earth will help visualize, monitor, and forecast natural and human activity on the planet. The model will be able to monitor the health of the planet, perform simulations of Earths interconnected system with human behavior, and support the field of sustainable development, therefore, reinforcing Europes efforts for a better environment in order to respond to the urgent challenges and targets addressed by the Green Deal.

Todays session opened with inspiring statements from ESAs Director General, Jan Wrner, ESAs Director of Earth Observation Programmes, Josef Aschbacher, ECMWFS Director General, Florence Rabier, European Commissions Deputy Director General for Defence Industry and Space, Pierre Delsaux, as well as Director General of DG CONNECT at the European Commission, Roberto Viola.

The -week 2020 opened on 28 September with inspiring statements from ESAs Director General, Jan Wrner (left) and ESAs Director of Earth Observation Programmes, Josef Aschbacher. Credit: ESA

Pierre Delsaux commented, As our EU Commission President repeated recently during her State of the Union speech, its clear we need to address climate change. The Copernicus program offers us some of the best instruments, satellites, to give us a complete picture of our planets health. But space is not only a monitoring tool, it is also about applied solutions for our economy to make it more green and more digital.

Roberto Viola said, -week is the week for disruptive technology and it is communities like this that our European programmes were designed to support.

Florence Rabier added, Machine learning and artificial intelligence could improve the realism and efficiency of the Digital Twin Earth especially for extreme weather events and numerical forecast models.

Jan Wrner concluded, -week is the perfect example of the New Space approach focusing on disruptive innovation, artificial intelligence, agility and flexibility.

During the week, experts will come together to discuss the role of artificial intelligence for the Digital Twin Earth concept, its practical implementation, the infrastructure requirements needed to build the Digital Twin Earth, and present ideas on how industries and the science community can contribute.

Cloud mask from -sat-1. Credit: Cosine remote sensing B.V

Earlier this month, on 3 September, the first artificial intelligence (AI) technology carried onboard a European Earth observation mission, -sat-1, was launched from Europes spaceport in French Guiana. An enhancement of the Federated Satellite Systems mission (FSSCat), the pioneering artificial intelligence technology is the first experiment to improve the efficiency of sending vast quantities of data back to Earth.

Today, ESA, along with cosine remote sensing, are happy to reveal the first ever hardware-accelerated AI inference of Earth observation images on an in-orbit satellite performed by a Deep Convolutional Neural Network, developed by the University of Pisa.

-sat-1 has successfully enabled the pre-filtering of Earth observation data so that only relevant part of the image with usable information are downlinked to the ground, thereby improving bandwidth utilization and significantly reducing aggregated downlink costs.

Initial data downlinked from the satellite has shown that the AI-powered automatic cloud detection algorithm has correctly sorted hyperspectral Earth observation imagery from the satellites sensor into cloudy and non-cloudy pixels.

Lake Tharthar, Iraq. Credit: Cosine remote sensing B.V

Massimiliano Pastena, -sat-1 Technical Officer at ESA, commented, We have just entered the history of space.

Todays successful application of the Ubotica Artificial Intelligence technology, which is powered by the Intel Movidius Myriad 2 Vision Processing Unit, has demonstrated real on-board data processing autonomy.

Aubrey Dunne, Co-Founder and Vice President of Engineering at Ubotica Technologies, said, We are very excited to be a key part of what is to our knowledge the first ever demonstration of AI applied to Earth Observation data on a flying satellite. This is a watershed moment both for onboard processing of satellite data, and for the future of AI inference in orbital applications.

As the overall 2017 Copernicus Masters winner, FSSCat, was proposed by Spains Universitat Politcnica de Catalunya and developed by a consortium of European companies and institutes including Tyvak International.

Also mentioned in his opening speech this morning, Josef Aschbacher made a special announcement regarding an exciting new ESA initiative, the EOP AI-enhanced Quantum Initiative for EO QC4EO in collaboration with the European Organization for Nuclear Research (CERN).

Quantum computing has the potential to improve performance, decrease computational costs and solve previously intractable problems in Earth observation by exploiting quantum phenomena such as superposition, entanglement, and tunneling.

Quantum computing has the potential to improve performance, decrease computational costs and solve previously intractable problems in Earth observation by exploiting quantum phenomena such as superposition, entanglement and tunneling. Credit: IBM

The initiative involves creating a quantum capability which will have the ability to solve demanding Earth observation problems by using artificial intelligence to support programmes such as Digital Twin Earth and Copernicus. The initiative will be developed at the -lab an ESA laboratory at ESAs center for Earth observation in Italy, which embraces transformational innovation in Earth observation.

ESA and CERN enjoy a long-standing collaboration, centered on technological matters and fundamental physics. This collaboration will be extended to link to the CERN Quantum Technology Initiative, which was announced in June 2020 by the CERN Director General, Fabiola Gianotti.

Through this partnership, ESA and CERN will create new synergies, building on their common experience in big data, data mining and pattern recognition.

Giuseppe Borghi, Head of the -lab, said, Quantum computing together with AI are perhaps the most promising breakthrough to come along in computer technology. In the coming years, we will see more Earth or space science disciplines employing current or future quantum computing techniques to solve geoscience problems.

Josef Aschbacher added, ESA will exploit the broad range of specialized expertise available at ESA and we will place ourselves in a unique position and take a leading role in the development of quantum technologies in the Earth observation domain.

Alberto Di Meglio, Coordinator of the CERN Quantum Technology Initiative, said, Quantum technologies are a rapidly growing field of research and their applications have the potential to revolutionize the way we do science. Preparing for that paradigm change, by building knowledge and tools, is essential. This new collaboration on quantum technologies bears great promise.

See the original post:
ESAs -Week: Digital Twin Earth, Quantum Computing and AI Take Center Stage - SciTechDaily

Under the dragons thumb: Chinese heft in VPNs and Indias vulnerability in a quantum-computing era – Economic Times

Concept by Muhabit ul haq

India, a booming hub of user data, is among the most exposed in the world to cyberattacks. While it ranks second in VPN usage globally, more than half of free VPN apps available over the Internet in the country have Chinese links. Given Indias volatile relation with its neighbour, securing users data from Chinese clutches should be a top priority.

The hunger of a dragon is slow to wake, but hard to sate. Ursula K Le Guin.Kevin Kane and his team of five at Ambit Inc., a US-based post-quantum network-security startup founded in 2019, have been working to create a quantum-resistant virtual private network (VPN) application. The reason: Chinas near-monopoly in the worlds free VPN market and the vulnerability of traditional security infrastructure in the dawning era of quantum computing.

BY

AbcSmall

AbcMedium

AbcLarge

Access the exclusive Economic Times stories, Editorial and Expert opinion

Already a Member? Sign In now

Sharp Insight-rich, Indepth stories across 20+ sectors

Access the exclusive Economic Times stories, Editorial and Expert opinion

Clean experience withMinimal Ads

Comment & Engage with ET Prime community

Exclusive invites to Virtual Events with Industry Leaders

A trusted team of Journalists & Analysts who can best filter signal from noise

Originally posted here:
Under the dragons thumb: Chinese heft in VPNs and Indias vulnerability in a quantum-computing era - Economic Times

IBM, Alphabet and well-funded startups in the race for quantum supremacy – IT Brief Australia

GlobalData, the worldwide data analysts, have offered new research that suggests that many companies are joining the race for quantum supremacy, that is, to be the first to make significant headway with quantum computing.

Quantum computers are a step closer to reality to solve certain real life problems that are beyond the capability of conventional computers, the analysts state.

However, the biggest challenge is that these machines should be able to manipulate several dozens of quantum bits or qubits to achieve impressive computational performance.

As a result, a handful of companies have joined the race to increase the power of qubits and claim quantum supremacy, says GlobalData.

An analysis of GlobalDatas Disruptor Intelligence Center reveals various companies in the race to monetisequantum computing as an everyday tool for business.

IBM's latest quantum computer, accessible via cloud, boasts a 65-qubit Hummingbird chip. It is an advanced version of System Q, its first commercial quantum computer launched in 2019 that has 20 qubits. IBM plans to launch a 1,000-qubit system by the end of 2023.

Alphabet has built a 54-qubit processor Sycamore and demonstrated its quantum supremacy by performing a task of generating a random number in 200 seconds, which it claims would take the most advanced supercomputer 10,000 years to finish the task.

The company also unveiled its newest 72-qubit quantum computer Bristlecone.

Alibabas cloud service subsidiary Aliyun and the Chinese Academy of Sciences jointly launched an 11-qubit quantum computing service, which is available to the public on its quantum computing cloud platform.

Alibaba is the second enterprise to offer the service to public after IBM.

However, its not only the tech giants that are noteworthy. GlobalData finds that well-funded startups have also targeted the quantum computing space to develop hardware, algorithms and security applications.

Some of them are Rigetti, Xanadu, 1Qbit, IonQ, ISARA, Q-CTRL and QxBranch.

Amazon, unlike the tech companies competing to launch quantum computers, is making quantum products of other companies available to users via Braket.

It currently supports quantum computing services from D-Wave, IonQ and Rigetti.

GlobalData principal disruptive tech analyst Kiran Raj says, Qubits can allow to create algorithms for the completion of a task with reduced computational complexity that cannot be achieved with traditional bits.

"Given such advantages, quantum computers can solve some of the intractable problems in cybersecurity, drug research, financial modelling, traffic optimisation and batteries to name a few.

Raj says, Albeit a far cry from the large-scale mainstream use, quantum computers are gearing up to be a transformative reality. They are highly expensive to build and it is hard to maintain the delicate state of superposition and entanglement of qubits.

"Despite such challenges, quantum computers will continue to progress into the future where companies may rent them to solve everyday problems the way they currently rent cloud services.

"It may not come as a surprise that quantum computing one day replaces artificial intelligence as the mainstream technology to help industries tackle problems they never would have attempted to solve before.

Originally posted here:
IBM, Alphabet and well-funded startups in the race for quantum supremacy - IT Brief Australia

ESAs -Week 2020 Highlights Digital Twin Earth, AI, and Quantum Computing – Science Times

This year's ESA's -week event started on September 28 and would last until October 2. It showcases a series of stimulating speeches about Digital Twin Earth, an update on -sat-1, and an exciting novel initiative that involves quantum computing.

ESA's 2020 -weekgives people to connect and form networks with experts, scientists, educators, students, developers, global industries, start-ups, and institutions in the field of space. It aims to explore the latest applications of transformative technologies and inspire early-career scientists, citizens, entrepreneurs.

The -week event goes virtual this year and focuses on how Earth observation contributes to Digital Twin Earth. The Digital Twin Earth provides a precise representation of Earth's past, present, and future changes.

Through Digital Twin World, human and nature activity on the planet will be visualized, monitored, and forecasted. Digital Twin Eart will monitor the Earth's health and conduct simulations of the interconnected system of Earth with human behavior, and support viable development that reinforces Europe's efforts for a better environment in response to Green Deal's the urgent challenges and targets.

Experts will discuss the concept, practical implementation, and infrastructure of the Digital Twin Earth and exhibit insights on the way industries. The community contributes to making the project successful during the ESA's 2020 -week.

On September 3, the first artificial technology (AI) was launched onboard the European Earth Observation Mission. The -sat-1 is the first of its kind and the first experiment in improving the efficiency of sending vast quantities of data back to Earth.

ESA and cosine remote sensing are delighted to reveal on the first day of ESA's -week event that the Deep Convolutional Neural Network has performed the first-ever hardware-accelerated artificial intelligence inference Earth observation images on an in-orbit satellite. It was the University of Pisa that developed the Deep Convolutional Neural Network.

The -sat-1was successful in prefiltering Earth observation data. Only the essential usable part of the image is downlinked to the ground, which improves the bandwidth utilization and significantly reduces the aggregated costs of the downlink.

Initial data coming from the satellite showed that that the automatic cloud detection algorithm operated by the AI has correctly filtered hyperspectral Earth observation imagery from the sensor of the satellite into cloudy and non-cloudy pixels.

Read Also: Watch! Latest Flyover Footage From ESA's Spacecraft Shows Stunning View of Ice-Filled Crater of Mars

As mentioned in the opening speech, the novel initiative involving quantum computingexploits quantum phenomena like superposition, entanglement, and tunneling to improve performance, decrease computational costs, and solve intractable problems in Earth observation.

The novel initiative uses artificial intelligence to support programs like Digital Twin Earth and Corpenicus in creating a quantum capability that can solve the demanding Earth observation problems. Quantum computing will be developed at ESA's -lab at ESA's center for Earth observation in Italy that embraces transformational observation.

ESA and CERN collaborated on many projects before, and this will be extended to the CERN Quantum Technology Initiative announced last June this year by Fabiola Gianotti, CERN Director-General.

Through this, both ESA and CERN will make new synergies and build on their shared experience in data mining, big data, and pattern recognition.

Read More: NASA/ESA's Hubble Captures Images of Cygnus Supernova Blast

Check out for more news and information on ESA at Science Times.

Go here to read the rest:
ESAs -Week 2020 Highlights Digital Twin Earth, AI, and Quantum Computing - Science Times

Quantum Computing in Aerospace and Defense Market Analysis, Trends, Opportunity, Size and Segment Forecasts to 2028 – Crypto Daily

This detailed market report focuses on data from different primary and secondary sources, and is analysed using various tools. It helps gives insights into the markets growth potential, which can help investors identify scope and opportunities. The analysis also provides details of each segment in the global Quantum Computing in Aerospace and Defense Market.

Sample Copy of This Report @ https://www.quincemarketinsights.com/request-sample-29723?utm_source=VN/SSK

The Quantum Computing in Aerospace and Defense market report highlights market opportunities and competitive scenarios for Quantum Computing in Aerospace and Defense on a regional and global basis. Market size estimation and forecasts have been provided based on a unique research design customized to the dynamics of the Quantum Computing in Aerospace and Defense market. Also, key factors impacting the growth of the Quantum Computing in Aerospace and Defense market have been identified with potential gravity.

The prominent players covered in this report: D-Wave Systems Inc, Qxbranch LLC, IBM Corporation, Cambridge Quantum Computing Ltd, 1qb Information Technologies Inc., QC Ware Corp., Magiq Technologies Inc., Station Q-Microsoft Corporation, and Rigetti Computing

The market is segmented into By Component (Hardware, Software, Services), By Application (QKD, Quantum Cryptanalysis, Quantum Sensing, Naval).

Major regions covered in the study include North America, Europe, Asia Pacific, Middle East & Africa, And South America.

Years Covered in the Study:

Historic Year: 2017-2018

Base Year: 2019

Estimated Year: 2020

Forecast Year: 2028

Get ToC for the overview of the premium report @ https://www.quincemarketinsights.com/request-toc-29723?utm_source=VN/SSK

Highlighted points of Quantum Computing in Aerospace and Defense market that covers the varying market dynamics of the industry:

This report on Quantum Computing in Aerospace and Defense market contains Answers to the following Questions:

Make an Enquiry for purchasing this Report @ https://www.quincemarketinsights.com/enquiry-before-buying/enquiry-before-buying-29723?utm_source=VN/SSK

About Us:

QMI has the most comprehensive collection of market research products and services available on the web. We deliver reports from virtually all major publications and refresh our list regularly to provide you with immediate online access to the worlds most extensive and up-to-date archive of professional insights into global markets, companies, goods, and patterns.

Contact Us:

Quince Market Insights

Ajay D. (Knowledge Partner)

Office No- A109

Pune, Maharashtra 411028

Phone: APAC +91 706 672 4848 / US +1 208 405 2835 / UK +44 1444 39 0986

Email: [emailprotected]

Web: https://www.quincemarketinsights.com

Continue reading here:
Quantum Computing in Aerospace and Defense Market Analysis, Trends, Opportunity, Size and Segment Forecasts to 2028 - Crypto Daily