Protein expression and purification

Gene encoding the TPR domain of T. cruzi PEX5 (347668) was optimized for E. coli codon usage, synthesized by Integrated DNA Technologies (Coralville, USA) and cloned between NcoI and NotI restriction enzyme sites into petHSU vector. The resulting construct contained an N-terminal Hexa-histidine (His6) tag and a SUMO tag. For AlphaScreen the same gene was amplified using forward 5-TACGACCATATGGAAACCAATTATCCTTTTG and reverse 5-TACGACCTC GAGAACCGCCATGTCCTCCAAG primers and cloned into pET-24a(+) vector between NdeI and XhoI restriction sites resulting in a construct containing C-terminal His6-tag.

The relevant plasmid was transformed into E. coli BL21 (DE3). A single colony was inoculated in 50mL LB medium containing 10g/mL kanamycin and incubated overnight at 37C. 5mL of the preliminary culture were used to inoculate 500mL of LB medium supplemented with 50g/mL kanamycin and incubated at 37C. When the OD600 reached 0.8, the culture was cooled to 20C, induced with 1mM isopropyl -d-1-thiogalactopyranoside(IPTG) and the culture was continued overnight. The cells were then harvested by centrifugation and resuspended in lysis buffer containing 50mM Hepes pH 7.5, 300mM NaCl, 20mM imidazole, 10mM -mercaptoethanol, 40M AEBSF-HCL (protease inhibitor), 1g/mL DNAaseI and lysed on ice by sonication. The lysate was clarified by ultracentrifugation. The supernatant was applied to a HiTrap IMAC column pre-equilibrated with the lysis buffer and washed with abundant washing buffer (50mM Hepes pH 7.5, 300mM NaCl, 20mM imidazole, 10mM -mercaptoethanol). The His-SUMO tag was cleaved off overnight, directly on column, using dtUD1 protease. The flow-through was then collected, concentrated to 5mL using a 30kDa cutoff Amicon Ultra filter and applied to a size exclusion chromatography on High load S75 pre-equilibrated with 20mM Hepes pH 7.5, 100mM NaCl and 5mM -mercaptoethanol. 6-His-tagged TcPEX5 variant was concentrated to 5mL and further purified by size exclusion chromatography on High load S75 pre-equilibrated with PBS supplemented with -mercaptoethanol straight after being eluted from HiTrap IMAC column. The protocol yielded on average 30mg of TcPEX5 from 1L of bacterial culture.

Perdeuterated 15N-labelled TcPEX5 was expressed in M9 minimal medium prepared in D2O and containing 15N-ammoniun chloride as the sole nitrogen source. 5mL of preliminary culture were used to inoculate 500mL of the same medium. Cells were grown at 37C until the OD600 reached 0.8, the culture was cooled to 18C, induced with 1mM IPTG and maintained overnight. The pellets were collected and the protein was purified as described above. In the last step of purification, the protein was applied to a size exclusion chromatography on S75 pre-equilibrated with NMR buffer (50mM phosphate buffer pH 7.4, 150mM NaCl and 5mM -mercaptoethanol).

All FP measurements were performed on a multifunctional microplate reader (Tecan InfinitePro F200 plate) in Corning NBSblack 96-well or 384-well NBS microplates. 485-nm excitation and 535-nm emission filters were used. The FP values were calculated as follows:

$$FP=frac{{I}_{parallel }-{I}_{perp }}{{I}_{parallel }+ {I}_{perp }}$$

where ({I}_{parallel }) and ({I}_{perp }) are the emission light intensity parallel and perpendicular to the excitation light plane, respectively. Fluorescence polarization values were expressed in millipolarization units (mP).

In the FP saturation binding experiment, 10nM 6-FAM-labelled PTS1 (6-FAM-YQSKL) was mixed with increasing concentrations of TcPEX5 (0.1250nM) in FP buffer containing 10mM Hepes pH 7.5, 100mM NaCl and 5% DMSO. Each data point was determined in triplicate. The FP values were plotted against the log10 of the protein concentration, and the dissociation constant (Kd) was obtained by fitting the experimental data using an equation representing a one site non-cooperative ligand binding:

$$FP={FP}_{min}times frac{left({FP}_{max}- {FP}_{min}right)times c}{{K}_{d}+c}$$

where FP is the determined value of the fluorescence polarization, FPmin is the value of the fluorescence polarization of the peptide alone, FPmax is the maximum value of the fluorescence polarization (saturation), Kd is the dissociation constant and c is the protein concentration.

Competitive binding experiment was performed at 10nM 6-FAM-labeled PTS1 and TcPEX5 concentration yielding f0=0.8 according to Huang18. An in-house 30,000 molecules diversity set (ChemBridge, ChemDiv, Enamine, PPI) and FDA-approved drug library were used in high throughput screening. The selection criteria for the diversity libraries are: (i) diversity within each library and between the 3 diversity sets; (ii) MW<600g/mol; (iii) compounds with acceptable logS/logP for solubility; (iv) Lipinskis rule of 5; (v) Purity>90%. Reactive, unstable and toxic chemical groups, chemotypes of known acute or chronic toxicity and trivial compounds present in commercial random libraries have been filtered out. Each tested compound (50mM in DMSO) was transferred into each well of 384-well assay plate with a robotic delivery system. Mixtures containing 30nM TcPEX5 and 10nM 6-FAM-PTS1 were dispensed into the compound containing wells with a reagent dispenser. In each assay plate, DMSO and unlabeled PTS peptide were used as negative and positive controls, respectively. Wells containing 10nM 6-FAM-PTS1 only were used as additional controls. The inhibitory activities were calculated using the following equation: %Inhibition=100(mPnmPs)/(mPnmPp); where mPn, mPp, and mPs represent FP values of the negative controls, positive controls, and compound samples, respectively.

Prior to HTS the assay performance was evaluated using Z test according to19:

$${Z}^{{prime}}=frac{1-(3{SD}_{n}+3 {SD}_{p})}{{mu }_{n}-{mu }_{p}}$$

where SDn and SDp are the standard deviations, and n and p represent the means of the FP values obtained from the negative and positive controls, respectively. For this test each 384-well plate contained 190 negative control wells (labelled peptide and protein), 190 positive control wells (labeled peptide, protein, and unlabeled PTS1), and four 6-FAM-PTS1 only wells. All experiments were repeated three times.

1H, 15N heteronuclear single quantum coherence (HSQC) spectra were measured for uniformly perdeuterated 15N-labeled TcPEX5 (120M) in the absence or presence of ligands at 1:1 protein:ligand molar ratio. 10% (v/v) of D2O was added to the samples to provide the lock signal. Water suppression was carried out using the WATERGATE sequence20. All spectra were recorded at 298K using a Bruker Avance 600MHz spectrometer with a cryogenic TCI probehead. 1H15N heteronuclear correlations were obtained using the SOFAST-HSQC experiment21. Spectra were processed and visualized using TopSpin 4.0.2.

AlphaScreen assay was used as an orthogonal assay to test the ability of compounds of interest to dissociate PEX5PTS1 interaction. 100nM N-His-PEX5 was mixed with 50nM biotinylated PTS1 (YQSKL) in a PBS buffer supplemented with 5mg/mL of BSA and 0.01% (v/v) Tween-20. 5g/mL of streptavidin donor beads and 5g/mL of nickel chelate acceptor beads (PerkinElmer) were added to the mixture. For EC50 determination, serial dilutions of the inhibitors prepared in DMSO were added while keeping constant concentration of DMSO at 5% (this concentration was shown to have no effect on the assay readout). Signal was determined according to the bead manufacturer instructions. Data were analyzed using Origin Pro 9.0. Experimental points were interpreted using Hill sigmoidal fitting fixing the asymptotes at the maximal assay signal (no inhibitor added) and 0, respectively.

The trypanocidal activity of tested compounds was evaluated against T. brucei brucei bloodstream form (BSF) using resazurin-based 96-well plate assay. T. b. brucei BSF (Lister 427, MITat 1.2) parasites were grown in HMI-11 medium containing 10% fetal bovine serum (FBS) at 37C at 5% CO2. 1:1 serial dilutions (10 points) were prepared in quadruplicates for each compound in HMI-11 medium (100L/well). Additionally, each row contained a well without a compound and one with medium solely as controls. 100L of parasite cultures (4103/mL) were inoculated in all wells (except the control with medium alone) so that the final concentration of parasites was 2103/mL. The plates were incubated for 66h. 25L of 0.1mg/mL resazurin (in Hanks Balanced Salt Solution) was added to each well and further incubated till 72h timepoint. The reduction of resazurin was detected by following the fluorescence emission at 585nm (excitation 530nm) using a Synergy H1 microplate reader. The fluorescence emission of the well containing medium only was considered as background and subtracted from the fluorescence emission of other wells; then the percent survival values were calculated setting the fluorescence emission of the well without the compound at 100% survival. Experimental data points were fitted with a non-linear regression using GraphPad (6.04) and the half-maximal inhibitory concentration (IC50) values were derived from the corresponding sigmoidal doseresponse curves.

Original post:
Small molecule mediated inhibition of protein cargo recognition by peroxisomal transport receptor PEX5 is toxic to Trypanosoma | Scientific Reports -...

Experiments from the UNC School of Medicine lab of Nobel Prize-winning scientist Aziz Sancar, MD, PhD, show how a common molecular tool for DNA labeling also has anticancer properties worthy of further investigation, especially for brain cancers.

CHAPEL HILL, NC Scientists at the UNC School of Medicine have made the surprising discovery that a molecule called EdU, which is commonly used in laboratory experiments to label DNA, is in fact recognized by human cells as DNA damage, triggering a runaway process of DNA repair that is eventually fatal to affected cells, including cancer cells.

The discovery, published in the Proceedings of the National Academy of Sciences, points to the possibility of using EdU as the basis for a cancer treatment, given its toxicity and its selectivity for cells that divide fast.

The unexpected properties of EdU suggest it would be worthwhile to conduct further studies of its potential, particularly against brain cancers, said study senior author Aziz Sancar, MD, PhD, the Sarah Graham Kenan Professor of Biochemistry and Biophysics at the UNC School of Medicine and member of the UNC Lineberger Comprehensive Cancer Center. We want to stress that this is a basic but important scientific discovery. The scientific community has much work ahead to figure out if EdU could actually become a weapon against cancer.

EdU (5-ethynyl-2-deoxyuridine) is essentially a popular scientific tool first synthesized in 2008 as an analog, or chemical mimic, of the DNA building block thymidine which represents the letter T in the DNA code of adenine (A), cytosine (C), guanine (G) and thymine (T). Scientists add EdU to cells in lab experiments to replace the thymidine in DNA. Unlike other thymidine analogs, it has a convenient chemical handle to which fluorescent probe molecules will bond tightly. It thus can be used relatively easily and efficiently to label and track DNA, for example in studies of the DNA replication process during cell division.

Since 2008, scientists have used EdU as a tool in this way, as published in thousands of studies. Sancar, who won the 2015 Nobel Prize for Chemistry for his seminal work on DNA repair, is one such scientist. When his lab began using EdU, his team unexpectedly observed that EdU-labeled DNA triggered a DNA repair response even when it wasnt exposed to DNA-damaging agents, such as ultraviolet light.

That was quite a shock, Sancar said. So we decided to explore it further.

Following up on the strange observation, the team discovered that EdU, for reasons that are still unclear, alters DNA in a way that provokes a repair response called nucleotide excision repair. This process involves the removal of a short stretch of damaged DNA and re-synthesis of a replacement strand. This is the mechanism that repairs most damage from ultraviolet light, cigarette smoke, and DNA-altering chemo drugs. The researchers mapped EdU-induced excision repair at high resolution and found that it occurs across the genome, and it apparently occurs again and again, since each new repair strand includes EdU and thus provokes the repair response anew.

It had been known that EdU is moderately toxic to cells, though the mechanism of its toxicity had been a mystery. The teams findings strongly suggest that EdU kills cells by inducing a runaway process of futile excision repair, which ultimately leads the cell to terminate itself through a programmed cell-death process called apoptosis.

That discovery was interesting in its own right, Sancar said, because it suggested that researchers using EdU to label DNA need to take into account its triggering of runaway excision repair.

As we speak, hundreds and maybe thousands of researchers use EdU to study DNA replication and cell proliferation in lab experiments without knowing that human cells detect it as DNA damage, Sancar said.

Sancar and colleagues also realized that EdUs properties might make it the basis for an effective brain cancer drug because EdU becomes incorporated into DNA only in cells that are actively dividing, whereas, in the brain, most healthy cells are non-dividing. Thus, in principle, EdU could kill fast-dividing cancerous brain cells while sparing non-dividing, healthy brain cells.

Sancar and his team hope to pursue follow-up collaborations with other researchers to investigate EdUs properties as an anticancer agent.

Prior studies have already found evidence that EdU kills cancer cells, including brain cancer cells, but strangely, no one has ever followed up on those results, Sancar said.

Nucleotide excision repair removes thymidine analog 5-ethynyl-2-deoxyuridine from the mammalian genome was co-authored by Li Wang, Xuemei Cao, Yanyan Yang, Cansu Kose, Hiroaki Kawara, Laura Lindsey-Boltz, Christopher Selby, and Aziz Sancar. Funding was provided by the National Institutes of Health (GM118102, ES02755).

Media contact: Mark Derewicz, UNC School of Medicine, 919-923-0959

View post:
Scientists Discover Surprise Anticancer Properties of Common Lab Molecule | Newsroom - UNC Health and UNC School of Medicine

The James Madison University Board of Visitors met Friday, April 22, 2022 in the Festival Conference and Student Center.

The following is a summary of actions taken by the board and key areas of discussion at the board meeting:

Approved the February 18, 2022 Board of Visitors meeting minutes and the personnel action report;

Accepted committee reports from the Academic Excellence, Advancement and Engagement, Athletics, Audit, Governance, Finance and Physical Development, and Student Affairs committees;

An update on the General Assembly was provided by Caitlyn Read, Director of Government Relations;

The 2022-23 proposed tuition and fees and the proposed 2022-23 budget was presented by Towana Moore, Interim Vice President of Administration and Finance;

A reaffirmation of the Universitys mission statement was presented by Brian Charette, Special Assistant to the President;

A racial equity and diversity, equity and inclusion update was provided by Deborah Tompkins Johnson;

Tim Miller, Vice President for Student Affairs led an update on COVID-19;

The Board of Visitors voted to approve the proposed 2022-23 proposed tuition and fees, the 2022-23 proposed summer tuition and fees and the proposed 2022-23 budget, pending the outcome of the state budget;

It was voted by the Board of Visitors that the University reaffirm the current mission statement;

The Board of Visitors voted for the next Rector of the Board to be Maribeth Herod, Vice Rector to be Chris Falcon and Secretary of the Board Donna Harper.

President Alger shared during his Presidents Report:

Link:
Board of Visitors summary of actions and discussions - James Madison University

April 26, 2022

Editor's note:This story is part of aseriesof profiles ofnotablespring 2022 graduates.

Miriam Goras has always been fascinated by simple, fundamental questions relating to how nature works, and during her first semester as a sophomore at Arizona State University she began a research regime investigating the underpinnings of Alzheimers disease. Double major Miriam Goras was recently awarded a prestigious Fulbright fellowship to conduct research in Norway. Download Full Image

I decided to pursue a biochemistry and neuroscience double major because they are research-intensive and I wanted to be able to closely connect the material I learned in the classroom with what I was doing in the lab, explained Goras.

She is about to graduate from the School of Molecular Sciences (SMS) and Barrett, The Honors College with a double major in biochemistry and neuroscience. She has also recently been awarded a prestigious Fulbright fellowship to conduct research in Norway.

Goras has received multiple honors and awards while attending ASU including the 2021 SMS Moeller Award.

This scholarship provides me with the opportunity to get involved in outreach programs for young women who may not have many female role models in STEM as happened to me growing up, Goras said.

As one of ASUs Lincoln Scholars, Goras put into practice her passion for equity in STEM.

She started small by becoming a member of Education for Humanity, where she mentored young female college students in science to help them navigate their way through their college endeavors.

Goras was also named a SOLUR undergraduate research fellow, which allowed her to prioritize her outreach efforts. She has participated in a variety of educational outreach programs to get the younger public excited about recent science and biochemical breakthroughs.

Question: What was your aha moment when you realized you wanted to study the field you majored in?

Answer: I entered college as a biology major I have always been fascinated by simple, fundamental questions about how nature works. The fall semester after my first year at ASU, I joined Professor Paul Colemans lab at the Biodesign Institute. Much of my interest in biochemistry and neuroscience as a field stemmed from what I was learning in the lab investigating the underpinnings of Alzheimers disease. I later decided to pursue a biochemistry and neuroscience double major because they are research-intensive and I wanted to be able to closely connect the material I learned in the classroom with what I was doing in the lab.

Q: Whats something you learned while at ASU in the classroom or otherwise that surprised you or changed your perspective?

A: A valuable lesson that I learned during my time at ASU is that as a scientist, my values and subjectivity inevitably affect my work. However, taking part in ethical discourse will allow me to become aware of my personal biases and identify gaps in my ethical decision-making process in research. Thinking critically about ethical norms will prompt me to examine the aims of my research and determine my responsibilities as a researcher. Recognizing that scientific progress is rooted in creative ethical inquiry, I believe that having my perspective challenged will strengthen the connection between discovery at the bench and innovation in the real world.

Q: Why did you choose ASU?

A: I chose ASU because of the limitless resources and opportunities available, ranging from access to expert faculty to potential scholarships and impactful activities. The culture of diversity and inclusion at ASU encourages growth through cooperation and support. Therefore, I knew coming here would allow me to thrive and develop as an individual and future professional.

Q: Which professor taught you the most important lesson while at ASU?

A: Its difficult to narrow it down to just one professor and one lesson because of all the amazing professors I have had at ASU, but I will mention three of them. Professor Susan Holechek taught me the importance of mentorship, especially as a female in STEM. Of not only having a mentor who supports your goals and wants you to thrive but also serving as a mentor for others and uplifting those who were in the same shoes as you when you started. Professor Scott Lefler of SMS taught me perseverance through some of the most difficult college courses Ive taken at ASU. Professor Samuel McClure taught me the value of pursuing your passions. His enthusiasm for the course subject and for teaching clearly comes through, which is inspiring.

Q: Whats the best piece of advice youd give to those still in school?

A: My best advice is to spend time exploring. I took Spanish/Chicano literature courses, dance classes and even graduate seminars, all of which enriched my experience at ASU. There are so many amazing classes at ASU, it is important to take advantage of them.

Q: What was your favorite spot on campus, whether for studying, meeting friends or just thinking about life?

A: My favorite place to study on campus is Hayden Library on the second floor. Nothing beats studying by windows where you can enjoy a beautiful view of campus or watch the sunset at night.

Q: What are your plans aftergraduation?

A: I have recently been awarded a Fulbright fellowship to conduct research in Norway and was accepted into the interdepartmental graduate program at Northwestern University to pursue a doctorate in neuroscience. I will do both, because Northwestern gave me permission to defer my enrollment until after I complete the Fulbright work.

Q: If someone gave you $40 million to solve one problem on our planet, what would you tackle?

A: I would spend the money on efforts to make education more accessible and equitable. Everyone should have access to high-quality education regardless of income, gender, location, race or background. Through equitable education, you empower more people to become critical thinkers and problem solvers who apply their knowledge to complex and novel challenges.

Read the rest here:
SMS grad who lives her passion for STEM rewarded with Fulbright Fellowship - ASU News Now

McGill has bestowed internal recognition awards on three cohorts of McGill professors. Nine senior scholars received James McGill Professor (JMP) awards. Thirteen tenure-track assistant or associate professors received William Dawson Scholar (WDS) awards, five for a second five-year term. Eleven scholars became Distinguished James McGill Professors (DJMP)McGills highest honourawarded to late-career scholars whose work exemplifies excellence and international leadership.

McGill is home to outstanding scholars doing excellent research on some of the worlds greatest challenges. Each year, I am honoured to congratulate the winners of the WDS, JMP and DJMP awards and to spotlight the research leadership of these highly accomplished individuals, said Christopher Manfredi, Provost and Vice-Principal (Academic). My sincere congratulations to all the honourees.

Among those who received the Distinguished James McGill Professor award are Dr. Louise Pilote of the Faculty of Medicine and Health Sciences, and Gregory Dudek of the Faculty of Science. A leader in womens cardiovascular health research, Dr. Pilote was recently appointed as Deputy Director of the Research Institute of the McGill University Health Centre (RI-MUHC). Professor Dudek is a globally recognized expert in AI and robotics who serves as vice-president of research at Samsung Electronics and leads the Samsung AI Center Montral, which recently doubled the size of its state-of-the-art facility and increased its team of research scientists.

The James McGill Professor awardees in 2022 include Bioresource Engineering Professor Valrie Orsat, an internationally-recognized expert in the development of functional foods, also known as nutraceuticals, in efforts to address global food security and safety challenges. Last year she received an Engineering and Physical Sciences Suffrage Science award for research excellence and for her role as a mentor for women entering the field. Another JMP awardee is Martin Schmeing, a professor in the Department of Biochemistry, who in 2020 co-led the team that developed a McGill-made version of the RT-PCR (reverse transcription polymerase chain reaction) test for COVID-19, the gold standard for identifying infections. The team produced over 15,000 tests for use by the MUHC testing facility and then set an ambitious goal to provide millions of RT-PCR tests to the Canadian government.

The William Dawson Scholar(WDS) award recognizes a scholar developing into an outstanding and original researcher who is poised to become an internationally recognized leader in their field. Among the newly appointed WDS awardees is Wendell Nii Laryea Adjetey whose first monograph, Cross-Border Cosmopolitans: The Making of a Pan-African North America, published this year, stems from his doctoral dissertation which won Yale Universitys Edwin M. Small Prize for outstanding contribution to U.S. history, Sylvia Ardyn Boone Prize for African American Studies, the Canadian Studies Prize, and the Willard Woody Brittain, Jr. Award. The book situates fundamental questions of twentieth-century U.S. historyimmigration, civil rights, racial identity, radicalism, surveillance and state powerwithin a North American diasporic frame.

Both the JMP and WDS awards come with an annual salary supplement and an annual research allowance not exceeding $25,000. The Distinguished James McGill Professor award provides for a $10,000 academic stipend or a $15,000 research grant allowance. DJMPs have held James McGill Professorships for two seven-year terms while maintaining an outstanding research record, or have held a Canada Research Chairs (Tier 1) for two seven-year terms. DJMP awardees hold the distinction until retirement, and those granted Emeritus status retain the title.

The 2022 DJMP, JMP and WDS cohort:

Distinguished James McGill Professors 11 honourees:

James McGill Professors 9 honourees:

William Dawson Scholar 13 honourees:

A current listing of all DJMP, JMP and WDS awardees:

Read the original post:
Provost honours 33 professors with Distinguished awards - McGill Reporter - McGill Reporter

New Jersey, United States,-The latest report published byMR Accuracy Reportsindicates that theC-Reactive Protein Test (CRP)Market is likely to accelerate strongly in the coming years. Analysts have studied market drivers, restraints, risks, and opportunities in the global market. The C-Reactive Protein Test (CRP) Market report shows the likely direction of the market in the coming years along with its estimates. An accurate study aims to understand the market price. By analyzing the competitive landscape, the authors of the report have made excellent efforts to help readers understand the key business tactics that major companies are using to maintain market sustainability.

Key Players Mentioned in the C-Reactive Protein Test (CRP) Market Research Report:Beckman Coulter, Roche, Siemens Healthcare, Ortho Clinical Diagnostics, Boditech, FUJIFILM, KANTO CHEMICAL, Kehua Group, Wondfo, Beijing Strong Biotechnologies, Getein Biotech, Randox Laboratories, Spinreact, BioSino, Leadman Biochemistry

Get Full PDF Sample Copy of Report:(Including Full TOC, List of Tables & Figures, Chart) @ https://www.mraccuracyreports.com/report-sample/481976

The report includes company profiles of almost all major players in the C-Reactive Protein Test (CRP) market. The Company Profiles section provides valuable analysis of strengths and weaknesses, business trends, recent advances, mergers and acquisitions, expansion plans, global presence, market presence, and portfolios of products from major market players. This information can be used by players and other market participants to maximize their profitability and streamline their business strategies. Our competitive analysis also provides vital information that will help new entrants identify barriers to entry and gauge the level of competitiveness in the C-Reactive Protein Test (CRP) market.

C-Reactive Protein Test (CRP) Market

ELISA, Immunoturbidimetric, CLIA, Others.

Application as below

Hospitals, Diagnostic Laboratories, Others

The global market for C-Reactive Protein Test (CRP) is segmented on the basis of product, type. All of these segments have been studied individually. The detailed investigation allows assessment of the factors influencing the C-Reactive Protein Test (CRP) Market. Experts have analyzed the nature of development, investments in research and development, changing consumption patterns, and growing number of applications. In addition, analysts have also evaluated the changing economics around the C-Reactive Protein Test (CRP) Market that are likely affect its course.

The regional analysis section of the report allows players to concentrate on high-growth regions and countries that could help them to expand their presence in the C-Reactive Protein Test (CRP) market. Apart from extending their footprint in the C-Reactive Protein Test (CRP) market, the regional analysis helps players to increase their sales while having a better understanding of customer behavior in specific regions and countries. The report provides CAGR, revenue, production, consumption, and other important statistics and figures related to the global as well as regional markets. It shows how different type, application, and regional segments are progressing in the C-Reactive Protein Test (CRP) market in terms of growth.

C-Reactive Protein Test (CRP) Market Report Scope

ESTIMATED YEAR 2022

BASE YEAR 2021

FORECAST YEAR 2029

HISTORICAL YEAR 2020

UNIT Value (USD Million/Billion)

The C-Reactive Protein Test (CRP) report provides information about the market area, which is further subdivided into sub-regions and countries/regions. In addition to the market share in each country and sub-region, this chapter of this report also contains information on profit opportunities. This chapter of the report mentions the market share and growth rate of each region, country and sub-region during the estimated period.

Please click here today to buy full report @https://www.mraccuracyreports.com/checkout/481976

Key questions answered in the report:

Note To provide a more accurate market forecast, all our reports will be updated prior to delivery considering the impact of COVID-19.

Visit link:
C-Reactive Protein Test (CRP) Market Biggest Innovation with Top Key Players Beckman Coulter, Roche, Siemens Healthcare, Ortho Clinical Diagnostics,...

UCI researchers have originated a simplified, faster clinical sample testing method to detect genetic material, including viral RNA. Their findings were recently published in the journal Scientific Reports. We showed that a saliva sample withdrawn using a simple microbiological loop can be directly analyzed in a single collection tube, using common and precise DNA amplification techniques such as RT-PCR and LAMP, for detecting viruses, said corresponding author Andrej Luptak, professor of pharmaceutical sciences. We significantly streamlined and accelerated the process through the elimination of several steps in sample collection, extraction, purification and further manipulation. They also discovered that by using a common detergent to denature the sample, it became noninfectious and much easier to handle. When the sample isnt manipulated outside the collection tube, there is virtually no risk of contamination of the testing equipment or personnel, enabling nonspecialists to conduct the procedure. We plan to apply this method for other types of clinical samples and potentially automate the process, Luptak said. Other researchers on the project were co-leaders Matthew Inlay, associate professor of molecular biology and biochemistry, and Bert Semler, Distinguished Professor of microbiology & molecular genetics; Kyle Cole, a graduate student in molecular biology; Alexis Bouin, a postdoctoral scholar in microbiology & molecular genetics; and assistant specialist Caila Ruiz, now at Zymo Research Corp.

View original post here:
UCI team develops simplified, faster process for detection of viral RNA in saliva samples - UCI News

In research reports, Global Biochemical Full Inspection Market Forecast 2022-2028, key research on the industry condition of the Biochemical Full Inspection is presented together with the best content, definition, expert opinion, SWOT analysis, meaning, and newest development around the world. The Biochemical Full Inspection research includes information on industry size, sales, price, revenue, market share, gross margin, growth rate, and cross structure. The study examines the profit made from the sale of this report and technologies across a number of segments, as well as provides a comprehensive table of contents on the Biochemical Full Inspection Market.

Get Latest Sample PDF Report: https://www.worldwidemarketreports.com/sample/720542

Segmentation based on Key players

Abbott Diagnostics Roche Boston Siemens

Segmentation based on Type

General Type

Segmentation based on Application

Medical

Get Latest Sample PDF Report: https://www.worldwidemarketreports.com/sample/720542

The research examines the Biochemical Full Inspection market in-depth, focusing on several factors such as drivers, restraints, opportunities, and threats. Before investing, stakeholders can use this information to make informed judgments. It also enables you to conduct useful competitive research in order to generate marketing ideas for your products. When it comes to customer happiness, its critical to have a clear understanding of whats going on in the market. The general market scenario is accurately described in this research.

Impact Of Covid-19 on Biochemical Full Inspection:

COVID-19 is an unprecedented global public health crisis that has impacted practically every business, and its long-term repercussions are expected to have an influence on industry growth during the forecast period. Our continuous study is enhancing our research approach to guarantee that fundamental COVID-19 concerns and potential solutions are included. The research examines COVID-19 in light of changes in consumer behavior and demand, purchasing patterns, supply chain re-routing, market dynamics, and government involvement. The updated study considers the impact of COVID-19 on the market and provides insights, analysis, projections, and forecasts.

Tap Here to See How This Biochemical Full Inspection Report Addresses COVID-19 Impact: https://www.worldwidemarketreports.com/covidimpact/720542

The following geographic segments are covered in the report:

The Biochemical Full Inspection report provides information on the market area, which is divided into sub-regions and countries/regions. In addition to the market share in each country and sub-region, this chapter in this report also contains information on profit opportunities. This chapter of the report mentions the market share and growth rate for each region, country, and sub-region during the estimated period.

North America includes the United States, Canada, and Mexico

Europe includes Germany, France, UK, Italy, Spain

South America includes Colombia, Argentina, Nigeria, and Chile

The Asia Pacific includes Japan, China, Korea, India, Saudi Arabia, and Southeast Asia

When analyzing the key market participants, what aspects are taken into account?

Key Questions Answered in the Report:

Or Else Place An Query For Biochemical Full Inspection Market Report Here: https://www.worldwidemarketreports.com/quiry/720542

Contact Us :

Mr. ShahWorldwide Market Reports,Tel: U.S. +1-415-871-0703U.K. +44-203-289-4040Japan +81-50-5539-1737Email: sales@worldwidemarketreports.comWebsite: https://www.worldwidemarketreports.com/

The rest is here:
Biochemical Full Inspection Market to Attain a Valuation of Highest CAGR, Updated Key Players Profile and Forecast to 2028: Abbott Diagnostics, Roche,...

While bright light helps us see better, our eyes need darkness for better vision. Light breaks down the sensitive machinery of our eyes every day, and during the darkness of night, key pieces are rebuilt. The clock of our circadian rhythms runs this process, and researchers have found that if the clock is disrupted, our eyes may be at greater risk of retinal degeneration as we age.

Purdue University photo/Tom Campbell

Fruit flies give insight into age-related changes in human vision. A team of researchers discovered the circadian clock plays a significant role in protecting eyes from retinal degeneration. The team studied fruit flies, which serve as a good model for the human retina. Vikki Weake, associate professor of biochemistry in Purdue's College of Agriculture, led the team.

Imagine if we could slow or prevent vision loss from retinal degeneration, said Vikki Weake, associate professor of biochemistry in Purdue Universitys College of Agriculture, who led the study. To do this, we need to understand the molecular mechanisms that drive age-associated changes and the external and internal factors that influence them. In this study, we discovered the circadian clock plays a surprisingly significant role in age-related changes in the retina. This internal clock may be critical in advanced age to prevent retinal degeneration and maintain eye health.

The team studied the eyes of Drosophila flies, a common model for the human eye. However, the study was uncommon in its use of multiple time points during aging, focus on photoreceptor neurons and new data analysis approaches. The findings are detailed in a paper in PLOS Genetics.

In our earlier studies, just focusing on gene expression, we were missing part of the story, Weake said. By looking at changes in chromatin that alter access to the underlying DNA during aging, we were able to identify some of the transcription factors that drive these gene expression changes in the aging eye.

Weake acknowledges doctoral student Juan Jupa Jauregui-Lozano for the idea for and application of the bioinformatics technique used.

I came across a powerful bioinformatics technique that can identify changes in transcription factor activity, helping us to understand gene regulation, Jauregui-Lozano said. The results revealed that the transcription factors Clock and Cycle - known for their role in circadian rhythm showed progressive changes in activity with age. This fits with what we know about eye biology, and this unbiased approach led us to identify Clock and Cycle as interesting targets to study.

Purdue University photo/Tom Campbell

Vikki Weake, associate professor of biochemistry in Purdue's College of Agriculture, sits at a microscope in her lab.

The technique, called diffTF, looks at changes in DNA accessibility in chromatin between different conditions. It generates a panel of potential candidates to pursue, as opposed to a research team beginning with a target gene in mind.

Clock and Cycle were known for being master regulators of circadian rhythms, but we saw they also regulate nearly all of the genes involved in sensing light in the retina, Jauregui-Lozano said. When the Clock:Cycle complex is disrupted, flies are susceptible to light-dependent retinal degeneration, and light-independent increase of oxidative stress. In humans, disruption of circadian rhythms has been associated with the onset of several age-related eye diseases. This is another piece of the puzzle.

Regulating the time at which these proteins are made is important to protect the light-sensing neurons and retain vision, Weake said.

The proteins involved in sensing light are delicate and degrade during the day when they are exposed to light, she said. If the circadian clock is off and these proteins arent made at the right time, its a problem.

The study found this complex controlled gene expression of nearly 20% of the active genes in Drosophila photoreceptors. The study also found the complex was responsible for maintaining global levels of chromatin accessibility in photoreceptors, a critical step in transcription of genes.

Co-author Hana Hall, research assistant professor of biochemistry at Purdue, performed light and dark experiments to see the effect on gene transcription when she was a researcher in Weakes lab.

Unlike most cells in the human body, neurons dont divide and replicate. The death of neurons lead to degenerative disease, Hall said. Because of this the cellular processes involved in repairing and regulating them are especially important. Proteins achieve this, and genes control which proteins are produced.

Aging is the main risk factor for neurodegenerative disease, Hall said. If we can understand the mechanics of how things get off track or become misregulated in our later years, we may be able to prevent or slow down the progression of these diseases. Vision loss affects a persons lifespan, independence and quality of life. Even delaying onset by five years could make a tremendous difference. We have ideas, and we are going to seek the answers.

The research team also included doctoral student Sarah Stanhope and undergraduate students Kimaya Bakhle and Makayla M. Marlin.

The National Eye Institute of the NIH (R01EY024905) and the Bird Stair Research Fellowship and Ross Lynn Research Scholar funded this work.

This article originally appeared in Purdue Universitys Agriculture News and has been republished with permission.

More here:
A study of old flies offers new insight into retinal degeneration - ASBMB Today

In this study, we investigated the overall contribution of TV and TV/PV according to the risk group systems from DAmico criteria and NCCN guidelines and observed that TV significantly increased in the higher risk groups of both systems. The patients of the low risk group exhibited a TV of 23 cm3, with a tumor diameter between 1.4 and 1.6cm when the tumor is assumed to be spherical, and a TV between 1.3 and 1.4cm when the tumor is assumed to be a regular hexahedron. Large tumors awere significantly related to an increased postoperative BCR in our multi-variate Cox proportional hazard analyses. The preoperative PSA, clinical stage, prostate volume, percentage of positive biopsy cores, and maximal tumor length among positive biopsy cores were significantly related to high TV and high TV/PV in our multi-variate regression tests.

TV has been presented as a significant prognostic factor of PCa in several papers2, 4,5,6,7,8,9,10,11,12. Stamey et al. reported that cancer volume and high Gleason score were significantly related with worse BCR-free survival after analyzing the results of 379 patients who were treated with radical prostatectomy2. They argued that the exact way to predict cancer volume may be helpful in predicting the outcomes of PCa surgery. Subsequently, Nelson et al. investigated the effect of TV on pathologic outcomes and biochemical recurrence after surgery5. They concluded that TV directly correlated with pathological stage and PSA recurrence after radical prostatectomy; therefore, TV was revealed as an independent predictor for worse prognosis in patients with localized PCa. Another study by Chun et al. showed that cancer volume and high Gleason score were the independent predictors for postoperative BCR in their relatively large cohort of 780 participants treated with radical prostatectomy4. Furthermore, another study by Uhlman et al. analyzed data from a large cohort of 3528 participants who were treated with radical prostatectomy to evaluate the prognostic influence of TV16. They analyzed TV with BCR-free survival, even though significant difference existed in their BCR-free survival rates after univariate KaplanMeier analyses.

However, there were other studies showing contradictory results regarding the use of TV as a predictive prognostic factor13,14,15,16. Kikuchi et al. also analyzed a larger cohort of 1302 participants who were also treated with radical prostatectomy. They observed only a weak relationship with postoperative prognosis, but no statistically significant results were obtained from multi-variate analyses13. Merrill et al. analyzed a large cohort of 1833 participants who were also treated with radical prostatectomy and found that TV was significantly associated with a higher rate of BCR in the high pathologic Gleason score subgroup (3+4), but not in the Gleason 6 subgroup (3+3)15. Another study by May et al. reported that absolute TV was unable to predict postoperative BCR, unlike relative TV (TV/total prostate volume), which showed significant results in predicting prognosis14. However, in our study, TV and TV/PV were significant independent predictors predicting BCR. As for the accuracy of prediction, TV/PV and TV do not have a big difference, but it is easier and more beneficial to use TV/PV than TV (Fig.2; Supplementary Fig.1). And in our study, high TV was associated with worse clinical characteristics such as worth pathologic state, rate of EPE, SVI, high-risk group, more positive biopsy core, and longer tumor length. There is no consensus on this, but men with larger prostate will have higher testosterone levels than men with smaller prostate. It may be associated with more aggressive prostate cancer. It can be estimated that the more aggressive prostate cancer, the more active cell-to-cell migration or progression will be.

Lately, focal therapy is gaining more attention with clinical benefits in terms of better erectile and urinary functions after treatment22. However, there are still limitations for focal therapy, because tumor location cannot be exactly predicted using conventional imaging modalities and biopsy protocols23. The understanding of the epidemiology of TV is quite important when planning and finding optimal candidates for focal therapy. We observed from our results that the mean TV was about 2.0cc for very low risk, 3.1cc for low risk, and 3.2cc for favorable intermediate risk group. Patients in the unfavorable intermediate risk group showed significantly larger TV than those in the favorable intermediate risk group (3.23.7cc versus 5.24.8cc, P<0.001). From our volumetric results of TV, we believe that the optimal candidates for focal therapy could be patients between very low risk and favorable intermediate risk groups. However, the patients in the very low risk group should be recommended for active surveillance.

Our study is certainly not without limitations. First, it is limited by its retrospective analyses, even though the data on TV was prospectively accumulated. Second, there is a possibility of selection bias since we only included patients treated with radical prostatectomy. Third, the present study only analyzed the total TV but not the detailed pathologic information about number of tumors and location, which is also important for prognosis of PCa patients. Even so, we believe that we provided the most recent data regarding the actual epidemiology of TV in patients treated with radical prostatectomy, which makes our study clinically meaningful.

Read the original here:
The tumor volume after radical prostatectomy and its clinical impact on the prognosis of patients with localized prostate cancer | Scientific Reports...

The UNC Program for Public Discourse and General Alumni Association host Science and Democracy, an online Abbey Speaker Series event featuring a discussion about the interplay of science and politics this February.

The UNC Program for Public Discourse and General Alumni Association will hostScience and Democracy, an online Abbey Speaker Series event featuring a discussion about the interplay of science and politics. Contributors includeScience editor-in-chief and former UNC-Chapel Hill chancellor Holden Thorp 86 and Luana Maroja, associate professor of biology and chair of the Biochemistry and Molecular Biology Program at Williams College.

The event will take place February 8th at 5:30 p.m., and the discussion will be moderated by Chris Clemens, Jaroslav Folda Distinguished Professor of Physics and Astronomy at the University of North Carolina at Chapel Hill.

The event takes place over Zoom and is free and open to the public.Registration is available here.

Continue reading here:
Public Discourse and General Alumni Association Host Science and Democracy Speaker Series | Newsroom - UNC Health and UNC School of Medicine

BOCA RATON, Fla.--(BUSINESS WIRE)--Zero Gravity Solutions, Inc. (ZGSI or the Company) (Pink Sheets: ZGSI), an agricultural biotechnology company, announced that the International Journal of Biochemistry Research and Review has published a peer reviewed research paper outlining the mechanism by which the Companys technology activates plants innate disease defenses. In this illustrative case study, the Company identified new plant biomarkers expressed when a plant is under fungal attack and demonstrated how our technology successfully triggers plants natural fungal defenses, a response known as priming. The findings validate the technologys mode of action and pave the way for the Company to broaden its product suite with proprietary priming elicitors that enable plants to sustainably increase yield and protect against disease.

Identifying the molecular mechanism of BAM priming and the specific biomarkers it causes to express is a scientific breakthrough for the Company. Our research validates our theory that a plant's natural defenses are triggered by the Company's priming technology, stated Dr. Ravi Pottathil, Zero Gravity Solutions Chief Science Officer. We believe the next generation of sustainable agricultural solutions will come from priming applications. We intend to introduce novel elicitor formulations as part of our priming technology platform in the near future based upon the biomarkers we have identified.

The Company expects that use of priming technologies will be the next category of agricultural product innovation to achieve green and sustainable agriculture practices. The Companys technology platform, which has been validated through numerous third-party trials both domestically and internationally, is at the forefront of an expected increasing use of priming agents as potent tools to mitigate plant disease.

"The findings of our recent research, combined with the ongoing commercial success of our BAM-FX product, reinforces our position that our priming technology is a leading edge innovation that will continue to contribute strongly to the tools that a grower has available to naturally boost the biological potential of their crops," said Timothy Peach, CEO/CFO of Zero Gravity Solutions, Inc.

The referenced published research paper is available at: https://journalijbcrr.com/index.php/IJBCRR

About Zero Gravity Solutions, Inc.

Zero Gravity Solutions, Inc. is an agricultural biotechnology public company with technology derived from and designed for Space with significant applications here on Earth. These technologies are focused on providing valuable solutions to challenges facing world agriculture. The commercialization activities are being executed through ZGSIs two operating subsidiaries, BAM Agricultural Solutions, Inc. and Specialty Agricultural Solutions, Inc.

This press release may contain certain forward-looking statements within the meaning of Section 27A of the Securities Act of 1933, as amended, and Section 21E of the Securities Exchange Act of 1934, as amended. Investors are cautioned that such forward-looking statements involve risks and uncertainties, including without limitation, acceptance of the Companys products, increased levels of competition for the Company, new products and technological changes, the Companys dependence on third-party suppliers, and other risks detailed from time to time in the Companys periodic reports filed with the Securities and Exchange Commission. Except as required by applicable law or regulation, Zero Gravity Solutions undertakes no obligation to update these forward-looking statements to reflect events or circumstances that occur after the date on which such statements were made.

Here is the original post:
Zero Gravity Solutions, Inc.'s Announces the Publication of an Important Research Paper in the International Journal of Biochemistry Research and...

Madhuri Jayathirtha

Madhuri Jayathirtha of Bangalore, India will travel to Philadelphia, PA, on April 2-5th to attend and present her work at the ASBMB conference. The ASBMB 2022 Graduate Student Award will support her travel.

Jayathirtha is a Ph.D. candidate at Clarkson University who works in the Biochemistry and Proteomics Group under the supervision of Dr. Costel C. Darie, an Associate Professor in the Department of Chemistry & Biomolecular Science.

Jayathirtha will present her project entitled "Mass Spectrometry based Proteomics to Investigate and characterize the Human Jumping Translocation Breakpoint (hJTB) Protein using cancer cell lines. This study is used to investigate the function of human JTB. JTB protein is required for normal cell division. If you have too much of this protein, you get cancer, mostly prostate and breast cancer. Investigating the function of this protein will help in testing it as a potential serum biomarker for the identification of breast cancer.

I am very happy about the travel award, said Jayathirtha. This will be my first time at this ASBMB conference. Since my research completely focuses on cell biology and biochemistry, I am excited to present my work and discuss my project with the other members of the society, ended Jayathirtha.

Visit link:
Clarkson Ph.D. Candidate Wins Travel Award to Attend the American Society for Biochemistry and Molecular Biology Conference - Clarkson University News

Undergraduate researchers of today are the scientists of tomorrow. Supporting students to be independent, critical thinkers is essential, and giving them access to research opportunities helps to strengthen their own futures as well as the future of scientific research. As part of this effort, the Beckman Scholars Program provides the opportunity for exceptional undergraduate students in the chemical and biological sciences to grow as scientists through independent research and mentoring.

A prestigious award, the Beckman Scholars Program is only awarded to a handful of institutions that meet the criteria. These institutions must demonstrate a commitment to undergraduate research, have successfully competed at the national level for scientific research funding, and have dedicated faculty who have demonstrated an outstanding ability to mentor undergraduate students. As such, it is a great honor that one of this years 2022 Beckman Scholars Program grants has been awarded to the University of Arizona following a competitive process administered by the Arnold and Mabel Beckman Foundation. Pictured right are UArizona's last four Beckman Scholars: Catherine Weibel, Amanda Warner, Randall Eck, and Jamie Takashima.

The 2022 UArizona Beckman Scholars Program is being led by Dr. Daniela Zarnescu, a Molecular and Cellular Biology faculty member and experienced Beckman Mentor. Faculty mentors are drawn from three UArizona departments within the College of Science: Chemistry and Biochemistry, Ecology and Evolutionary Biology, and Molecular and Cellular Biology. The Program will be housed under the Undergraduate Biology Research Program (UBRP) and administered by Ms. Marisa Lester, UBRP Assistant Program Director. UBRP is an ongoing UArizona research initiative that has been on campus since 1988 and is designed to teach students science by involving them in research. UBPR will provide additional support for the selected Beckman Scholars by integrating them into a peer network of fellow undergraduate researchers as well as having the scholars participate in and co-lead workshops.

The 2022 award supports six undergraduate students, two a year for three years. Beckman Scholars will be selected through a careful process that includes an original research proposal that demonstrates the students creativity, analytical skills, and familiarity with the scientific process. Selected scholars will work with a faculty mentor on an independent research project. These mentors, who are also members of UBRP, were recruited based on their scientific expertise, experience working with undergraduates, and demonstrated mentoring commitment. The new scholars will also be supported by previous Beckman Scholars.

As part of the program, Beckman Scholars are encouraged to author a peer-reviewed publication of their research. This will help the students to develop their scientific writing skills as well as to better understand the peer-review process. Scholars will also develop leadership and professional skills by inviting and arranging for an eminent scholar to speak each year at a Beckman Lecture. These speakers will be supported by committed funds from Dr. Betsy Cantwell, the UArizona Senior Vice President for Research. Additionally, the scholars will communicate their research with the public through appearing on the weekly KXCI Community Radio program Thesis Thursday.

An important aspect of the recruitment and selection of scholars and mentors is a commitment to diversity, equity, and inclusion. Ethnic and racial minorities, people with disabilities, and first-generation students are often underrepresented in scientific research programs. As such, the 2022 Beckman Scholars Program will actively recruit and select students from the diverse student body of the University of Arizona. Additionally, Beckman mentors of the program represent a diverse group of faculty across the three participating departments.

Beckman Scholars are leaders amongst their peers and significant contributors to their respective areas of research. Beckman alumni have continued onward to professional and graduate programs at some of the world's more prestigious institutions. Receiving this award showcases the excellence in undergraduate research at the University of Arizona. For more information about the program at UArizona and the application process, please visit:https://ubrp.arizona.edu/programs/beckman-scholars-program.

By:Christine Acosta

View original post here:
University of Arizona Awarded the 2022 Beckman Scholars Program - University of Arizona News

The Research report provides an in-depth analysis of the impact of COVID-19 on numerous segments within the Heparin Sodium market-supported product types, applications, and key players like (Shenzhen Hepalink, Bioibrica, Nanjing King-friend, Pfizer, Dongcheng Biochemicals, Changshan Biochemical, and more) across various countries around the world. Further, the Heparin Sodium market report additionally provides insights into market developments, trends, provide and demand changes across numerous regions across the globe. The market is predicted to witness continuing growth throughout the forecast from 2022 to 2028. It commits various factors affecting industry like market environment, various policies of the government, past data and market trends, technological advancements, upcoming innovations, market risk factors, market restraints, and challenges within the industry. Then it analyzed the worlds main region market conditions, including the demand and supply chain analysis and industry rate of growth etc. At the top, the report introduced a new project SWOT analysis, investment feasibility analysis, and investment return analysis.

Request for Sample Copy of Heparin Sodium Market with Complete TOC and Figures & Graphs @ https://www.affluencemarketreports.com/industry-analysis/request-sample/2048578/

Whats Included in Sample Copy of Heparin Sodium Market Report:

Further, the report presents profiles of competitors in the Heparin Sodium market include:

The report provides an accurate analysis of the changing competitive dynamics. It provides a forward-looking perspective on the various factors that drive or restrict market growth. It provides a five-year forecast evaluated based on Heparin Sodium market growth projections. Helps in understanding the key product segments and their future, to gain a complete view of the market, and make informed business decisions by performing an in-depth analysis of the market segments.

Contact for Additional Customization in Heparin Sodium Market Report at https://www.affluencemarketreports.com/industry-analysis/request-inquiry/2048578/

Following Key Segments Covered in the Global Heparin Sodium Market Report:

Heparin Sodium Market Breakdown by Product Type:

Heparin Sodium Market Breakdown by Application:

Along with Heparin Sodium Market research analysis, buyer also gets valuable information about global Heparin Sodium Production and its market share, Revenue, Price and Gross Margin, Supply, Consumption, Export, import volume, and values for the following Regions:

Benefits of Heparin Sodium Market Report:

For More Details on the Impact of COVID-19 on Heparin Sodium Market, Connect with us at https://www.affluencemarketreports.com/industry-analysis/covid19-request/2048578/

For More Details Contact Us:

Affluence Market Reports

Contact Person: Mr. Rohit

Phone Number:

U.S: +1-(424) 256-1722

U.K.: +44 1158 88 1333

Email: [emailprotected]

Website: http://www.affluencemarketreports.com

Read the original post:
Qualitative Analysis of Heparin Sodium Market 2022-2028 Strategical Assessment of Shenzhen Hepalink, Bioibrica, Nanjing King-friend, Pfizer, Dongcheng...

This research, led by Jean Cook, PhD, and Liu Mei, PhD, at the UNC School of Medicine, may help explain why certain parts of the genome become highly mutable in some cancers.

CHAPEL HILL, NC A new study from scientists at the UNC School of Medicine has illuminated an important process that occurs during cell division and is a likely source of DNA damage under some circumstances, including cancer.

The scientists, who reported their findings in Nucleic Acids Research, devised a sophisticated experimental platform for studying the process called origin licensing. Cells use this process to regulate, or license the replication of their genomes during cell division.

The researchers revealed for the first time the dynamics of this process. They showed in particular how these dynamics differ and bring different risks of DNA damage during replication in the two basic states of genomic DNA, the euchromatin state which is relatively loose and open for gene activity, and the heterochromatin state which is wound more tightly to silence gene activity.

Our findings may help explain, for example, why certain portions of the genome are relatively susceptible to DNA damage during replication in some cancer cells, said study senior author Jean Cook, PhD, professor of biochemistry and biophysics at the UNC School of Medicine and member of the UNC Lineberger Comprehensive Cancer Center.

Origin licensing occurs in the initial, preparatory phase of cell replication, known as the G1 phase. It involves sets of special enzymes that attach to the DNA in chromosomes at various locations where DNA-copying is to originate. The enzymes essentially license the copying of DNA so that cells dont copy their genomes more than once.

Cook and other scientists have described in prior studies the basic process of origin licensing, and have identified proteins that make it happen. But this study, for the first time, revealed in detail how the process unfolds over time in cells as they prepare for cell division. Study first author Liu Mei, PhD, a postdoctoral fellow in the Cook laboratory, combined still and time-lapse microscopic imaging techniques to accomplish this feat.

What Liu did was incredibly painstaking and meticulous, a technical tour de force, Cook said.

As an initial demonstration of her experimental platform, Mei compared the origin licensing process, with its loading of licensing enzymes, in the two main states of the genome euchromatin and heterochromatin. She found an important difference.

Essentially heterochromatin more compacted DNA loads these licensing enzymes relatively late compared to what we observe in the more open euchromatin, Mei said.

This finding hinted, at least, that in dividing cells with an abnormally shortened G1 phase, the more compacted DNA in the cell genome might never be fully licensed for replication, potentially resulting in large mutations during replication and even cell death. Confirming this possibility, the researchers found that when they artificially shortened the G1 phase in test cells, there was significantly more under-replication and DNA damage in heterochromatin regions of the cells genomes, compared to the euchromatin regions.

Cells can have a shortened G1 phase for different reasons, including due to cancer. Thus the study suggests that the genomic instability or tendency to develop more mutations of some cancer types, as well as the genomic locations of that instability, might be explained in part by faulty origin licensing.

The study also establishes the researchers experimental platform as a tool for further studies of origin licensing dynamics and genomic instability, studies that might someday yield new strategies against cancers, for example.

The consequences of differential origin licensing dynamics in distinct chromatin environments was co-authored by Liu Mei, Katarzyna Kedziora, Eun-Ah Song, Jeremy Purvis, and Jean Cook, all at UNC Chapel Hill.

Funding was provided by the National Institutes of Health (R01GM102413, R01GM083024, R35GM141833, R01-GM138834).

Media contact: Mark Derewicz, 919-923-0959.

Read the rest here:
Ground-Breaking Study Reveals Dynamics of DNA Replication 'Licensing' | Newsroom - UNC Health and UNC School of Medicine

The Latest released Global Biochemical Oxygen Demand Analyzer Market Report 2021-2027 provides 100+ data Tables, Pie Chat, Graphs & Figures spread through Pages and easy to understand detailed analysis.

The Global Biochemical Oxygen Demand Analyzer Market Report provides an in-depth assessment of the given sectors current position and central factors.The study considers the present scenario of the Biochemical Oxygen Demand Analyzer market and its market dynamics for the period 2021-2027. It covers a detailed overview of several market growth enablers, restraints, and trends. The report offers both the demand and supply aspects of the market. It profiles and examines leading companies and other prominent ones operating in the market.

Top Key Players in the Global Biochemical Oxygen Demand Analyzer Market: HachLovibondXylemSkalarMANTECH-IncMettler ToledoThermo Fisher ScientificVELP ScientificaAQUALYTICLAR Process AnalysersKORBI

(Exclusive Offer: Flat 20% discount on this report)

Click the link to Get a Free Exclusive Sample Copy of the Report:

https://www.marketinsightsreports.com/reports/01265037245/global-biochemical-oxygen-demand-analyzer-sales-market-report-2021/inquiry?http://www.blackseagrain.net&mode=69

This report elaborates the market size, market characteristics, and market growth of the Biochemical Oxygen Demand Analyzer industry, and breaks down according to the type, application, and consumption area of Biochemical Oxygen Demand Analyzer. The report also conducted a PESTEL analysis of the industry to study the main influencing factors and entry barriers of the industry.

Segmentation By Type:

Portable BOD AnalyzerOnline BOD AnalyzerOthers

Segmentation By Application:

Municipal Wastewater Treatment PlantsIndustrial Production FacilitiesLaboratoriesOthers

Regional Analysis:

North America (United States, Canada and Mexico)Europe (Germany, France, UK, Russia and Italy)Asia-Pacific (China, Japan, Korea, India, Southeast Asia and Australia)South America (Brazil, Argentina, Colombia)Middle East and Africa (Saudi Arabia, UAE, Egypt, Nigeria and South Africa)

Explore Full Report with Detailed TOC Here

https://www.marketinsightsreports.com/reports/01265037245/global-biochemical-oxygen-demand-analyzer-sales-market-report-2021?http://www.blackseagrain.net&mode=69

Significant Features and Key Highlights of the Reports:

Detailed overview of Biochemical Oxygen Demand Analyzer Market Changing market dynamics of the industry In-depth market segmentation by Type, Application etc. Historical, current and projected market size in terms of volume and value. Recent industry trends and developments Competitive landscape of Biochemical Oxygen Demand Analyzer Market Strategies of key players and product offerings Potential and niche segments/regions exhibiting promising growth.

Key questions answered:

Who are the Leading key players and what are their Key Business plans in the Global Biochemical Oxygen Demand Analyzer market? What are the key concerns of the five forces analysis of the Global Biochemical Oxygen Demand Analyzer market? What are different prospects and threats faced by the dealers in the Global Biochemical Oxygen Demand Analyzer market? What are the strengths and weaknesses of the key vendors?

Customization of this Report:This report can be customized as per your needs for additional data up to 5 companies or countries or 40 analyst hours.

Contact Us:

Irfan Tamboli (Head of Sales) Market Insights Reports

Phone: + 1704 266 3234 | +91-750-707-8687

Email:sales@marketinsightsreports.com |irfan@marketinsightsreports.com

https://www.linkedin.com/company/13411016/https://twitter.com/MIRresearch

Follow this link:
Biochemical Oxygen Demand Analyzer Market Competitive Analysis With Growth Forecast Till 2027 - UkrAgroConsult

NEW ORLEANS The Men's and Women's Scholar-Athlete of the Year and All-Academic Athletes for the 2021 NCAA Division III Cross Country season were announced on Thursday by the U.S. Track & Field and Cross Country Coaches Association (USTFCCCA).

Both the men's and women's cross country teams earned USTFCCCA All-Academic Team honors, with the men's team recording a cumulative team GPA of 3.2, while the women's team recorded an impressive 3.59 cumulative GPA.

For the women's team, three Knights were awarded All-Academic Athletes, consisting of Bayleigh Redd, Sasha Willie, and Ashley Brewer, majoring in Biochemistry.Quin Meyer, majoring in Business Management, and Kaelen Ruder, majoring in Physical Therapy, represented the men's team.

The group played key roles for their teams in their 2021campaigns, finishing in the top 25 percent at the 2021 NCAA Division III South Region Cross Country Championships. Their performances, along with their academic achievements, qualified themselves for USTFCCCA All-Academic Awards.

Follow @knightxctf on Instagram and Twitter for more updates and details on the team.

Full USTFCCCA Release

See the rest here:
Men's and Women's Cross Country Earn All-Academic Honors - Southern Virginia - Southern Virginia University News

Azin Saebi was born and raised in Iran, emigrating to the U.S. with her family at 18 after graduating from high school. Now a fifth-year graduate student in chemistry, Saebi never intended to stay permanently; she initially expected to go back to Iran to attend university. With that in mind, when leaving for the U.S., she only packed a bag with enough belongings for a couple of months and had even booked a return flight.

Her plans changed, however, as she began to recognize the opportunities available to her at American colleges, and that the best way to improve her English would be to stay in the U.S. Since she hadnt taken the SAT or completed the requirements necessary to enter a traditional four-year college, she enrolled in community college with a plan to study biology and neuroscience, before transferring to UCLA.

In community college, Saebi discovered that she loved her undergraduate chemistry courses, so she joined an inorganic chemistry lab. I really clicked more with the day-to-day lab experiments in chemistry rather than biology. It was fun and exciting how I could take material A and material B, mix them together in a controlled way and get this new molecule, she says. To her, biology seemed like more of a black box. With chemistry, I could check the progress at every step along the way.

At MIT, Saebi is working at the intersection of chemistry and biology, designing novel strategies to synthesize proteins and to conjugate proteins together. Ultimately, these strategies have potential applications as antimicrobial compounds. In addition to her academic pursuits, she has devoted her time to advocating for diversity and inclusion initiatives and ensuring that students feel supported and heard within the chemistry department.

Lighting a fire of chemistry

When she started at Saddleback Community College, Saebi first chose to pursue a degree in neuroscience, with the intention of becoming a physician a path influenced by watching Greys Anatomy, she jokes. Taking organic chemistry also sparked an interest in the interface between chemistry and biology. A biochemistry course at UCLA further cemented this passion, and she found that she excelled in the subject. It was rather obvious that among neuroscience majors, [my reaction] to the class was an uncommon one, as it was generally considered a pretty irrelevant class to our core studies, she says.

Saebi decided to double major in neuroscience and biochemistry. An inspiring professor, Alexander Spokonyny, encouraged her to join his inorganic chemistry lab. He was the person that lit this fire of chemistry in me, she says. Under his guidance, she synthesized small-molecule inhibitors to study cocaine addiction.

In the fall of senior year, Saebi knew that she wanted to pursue this research thing and that her interest in medicine had taken a back seat. She decided to enroll in UCLAs 4+1 program to complete a masters degree in biochemistry before applying to graduate programs in chemistry.

Unleashing novel proteins and inner nerds

When Saebi was admitted to MIT, she was determined to take advantage of the opportunity. Growing up in Iran, I never imagined I would have the opportunity to go to a world-renowned university such as MIT, she says. During the chemistry departments visit weekend, where admitted students are invited to come to campus, she realized that students here actually looked like me in terms of the science they loved and the activities they were involved with.

Since beginning her PhD, Saebis aim has been to transition from organic chemistry to chemical biology. Even though I enjoyed doing organic chemistry, I really wanted to pursue something with direct applications, she notes. With this in mind, she decided to affiliate jointly with the labs of professor of chemistry Bradley Pentelute, and with Stephen Buchwald, the Camille Dreyfus Professor of Chemistry. The Buchwald lab focuses more on the organic chemistry methods, while the Pentelute lab focuses on peptides and emphasizes biological applications. I really enjoyed making molecules, but I also knew that that alone would not keep me satisfied during the five years of my PhD, Saebi explains. I needed to make sure that I made something that I could apply to the biotechnology industry or to human health.

The overall theme of Saebis work is developing novel chemical tools to modify biomolecules, specifically proteins. Her research has evolved in three distinct stages. First, she investigated a novel bioconjugation strategy, a chemical technique used to couple two proteins together. Then she worked on a method of synthesizing proteins via chemical ligation of amino acids, relying on chemical techniques to join the amino acids together instead of biological protein synthesis machinery. Most recently, Saebi has been combining these two tools, bioconjugation and chemical protein synthesis, to make antimicrobial compounds that specifically target and destroy Pseudomonas, a bacteria that can lead to serious infections in hospital patients.

Outside of lab, Saebi has served as a teaching assistant for course 5.07 (Introduction to Biological Chemistry). It turned into a fun experience of helping [undergraduate] students unleash their inner nerd, Saebi notes. Given that I had really enjoyed my biochemistry classes back at UCLA, I really wanted to make sure that my students had the same experience. She had to overcome her fear that, since English is her second language, students wouldnt understand her explanations. Despite her initial hesitations, Saebi won the Department of Chemistry Outstanding Teaching Award in 2018. For her, that was the cherry on top of a rewarding teaching experience.

Sparking change for graduate students

In the past two years, Saebi has become an advocate for diversity, inclusion, and speaking up about challenges within MIT, serving as a member of the chemistry departments Diversity, Equity and Inclusion Committee (DEIC) and co-president of Women+ in Chemistry (WIC+). Over time, Saebi has realized that one of her personal strengths is communicating student needs, a skill she has leveraged in these leadership roles.

Graduate school is hard, and nothing is going to make it an easy-breezy experience because science is inherently hard. But, there are things that can make graduate school a bit easier and a more enjoyable experience. Often we have the attitude that we will just suffer through it just because others before us have suffered through it, and thats a problem she says. Saebi is not content to just suffer through it; instead, she is determined to be the spark for change.

She is most proud of the holistic review of graduate admissions practices drafted by DEIC and implemented in chemistry admissions this year. The new practices evaluate candidates based on opportunities available to them, and their potential for growth, as well as their accomplishments.

She also serves with Resources for Easing Friction and Stress in the Chemistry Department (ChemREFS), which offers students an avenue to speak confidentially about their problems and to receive support. Learning about her peers struggles has informed her role in the DEIC, she says. ChemREFS is helpful to me to ensure that I am actually representing the student body and the diversity of voices and perspectives.

As she nears graduation, Saebi has been considering her next steps. She wants to continue solving problems in human health, and she understands that it can be a challenging and lengthy process translating academic research to new treatments for patients. I want to be somewhere that I can see the impact of my work on patients lives and health care more immediately, and Im grateful that my PhD at MIT has opened so many doors for me to explore science beyond academia, she says.

See more here:
Tackling chemical synthesis and advocacy | MIT News | Massachusetts Institute of Technology - MIT News

The latest study titled Global Colistin Sulphate Market 2022 by Key Players, Regions, Type, and Application, Forecast to 2028published by Affluence Market Report, features an analysis of the current and future scenario of the global Colistin Sulphate market.

In this report, a comprehensive analysis of the current global Colistin Sulphate market in terms of demand and supply environment is provided, as well as price trends currently and in the next few years. This report also includes global and regional market size and forecast, major product development trends, and typical downstream segment scenarios, under the context of market drivers and inhibitors analysis. The report overview includes studying the market scope, leading players like Shengxue Dacheng, Apeloa, Livzon Group, LKPC, Xellia, Qianjiang Biochemical, etc., market segments and sub-segments, market analysis by type, application, geography, and the remaining chapters that shed light on the overview of the Colistin Sulphate market

To Get Premium Quality Sample copy of Colistin Sulphate Market Report with Complete TOC, Figures & Graphs. Connect with us at: https://www.affluencemarketreports.com/industry-analysis/request-sample/2052241/

Colistin Sulphate Market Report Sample includes:

Global Colistin Sulphate Market: Segment Analysis

The research report includes specific segments by region (country), by company, by Type, and by Application. This study provides information about the sales and revenue during the historic and forecasted period of 2015 to 2028. Understanding the segments helps in identifying the importance of different factors that aid the market growth.

The key market players for the global Colistin Sulphate market are listed below:

Colistin Sulphate Market Segmented by Types

Colistin Sulphate Market Segmented by Applications

Contact for Additional Customization at https://www.affluencemarketreports.com/industry-analysis/request-inquiry/2052241/

Along with Colistin Sulphate Market research analysis, buyer also gets valuable information about global Colistin Sulphate Production and its market share, Revenue, Price and Gross Margin, Supply, Consumption, Export, import volume, and values for the following Regions:

Key Target Audience:

To Get Detailed Information about the Impact of COVID-19 on Colistin Sulphate Market, Connect with us athttps://www.affluencemarketreports.com/industry-analysis/covid19-request/2052241/

Key Aspects of Colistin Sulphate Market Report Indicated:

Get Extra Discount on Colistin Sulphate Market Report, If your Company is Listed in Above Key Players List @ https://www.affluencemarketreports.com/industry-analysis/request-discount/2052241/

About Affluence:

Affluence Market Reports is the next generation of all your research needs with a strong grapple on the worldwide market for industries, organizations, and governments. Our aim is to deliver exemplary reports that meet the definite needs of clients, which offers an adequate business technique, planning, and competitive landscape for new and existing industries that will develop your business needs.

We provide a premium in-depth statistical approach, a 360-degree market view that includes detailed segmentation, key trends, strategic recommendations, growth figures, Cost Analysis, new progress, evolving technologies, and forecasts by authentic agencies.

For More Details Contact Us:

Affluence Market Reports

Contact Person: Mr. Rohit

Phone Number:

U.S: +1-(424) 256-1722

U.K.: +44 1158 88 1333

Email: [emailprotected]

Website: http://www.affluencemarketreports.com

Continued here:
Growth Drivers of Colistin Sulphate Market with Relevancy Mapping by Key Player like Shengxue Dacheng, Apeloa, Livzon Group, LKPC, Xellia, Qianjiang...